added misc svn folders and new sql scirpt

Jonathan Bell [2012-01-12 20:57:41]
 added misc svn folders and new sql scirpt
Filename
genspace-common/disabled-src/msa/Alignment.java
genspace-common/disabled-src/msa/ProteinSequence.java
genspace-common/disabled-src/msa/Reference.java
genspace-common/src/org/geworkbench/components/genspace/entity/ToolStatCache.java
genspace-ejb/src-disabled/msa/MSARecommender.java
genspace-ejb/src-disabled/msa/MSARecommenderLocal.java
geworkbench-core/classes/.svn/all-wcprops
geworkbench-core/classes/.svn/dir-prop-base
geworkbench-core/classes/.svn/entries
geworkbench-core/classes/.svn/prop-base/.cvsignore.svn-base
geworkbench-core/classes/.svn/prop-base/ConfigurationFile Schema.xsd.svn-base
geworkbench-core/classes/.svn/prop-base/Descriptor Schema.xsd.svn-base
geworkbench-core/classes/.svn/prop-base/all.xml.svn-base
geworkbench-core/classes/.svn/prop-base/application.properties.svn-base
geworkbench-core/classes/.svn/prop-base/bioproc.anno.svn-base
geworkbench-core/classes/.svn/prop-base/cellcomp.anno.svn-base
geworkbench-core/classes/.svn/prop-base/client-config.wsdd.svn-base
geworkbench-core/classes/.svn/prop-base/go.onto.svn-base
geworkbench-core/classes/.svn/prop-base/kegg.anno.svn-base
geworkbench-core/classes/.svn/prop-base/kegg.onto.svn-base
geworkbench-core/classes/.svn/prop-base/log4j.properties.svn-base
geworkbench-core/classes/.svn/prop-base/manifest.svn-base
geworkbench-core/classes/.svn/prop-base/molfunc.anno.svn-base
geworkbench-core/classes/.svn/prop-base/yeast.syno.svn-base
geworkbench-core/classes/.svn/text-base/.cvsignore.svn-base
geworkbench-core/classes/.svn/text-base/ConfigurationFile Schema.xsd.svn-base
geworkbench-core/classes/.svn/text-base/Descriptor Schema.xsd.svn-base
geworkbench-core/classes/.svn/text-base/all.xml.svn-base
geworkbench-core/classes/.svn/text-base/application.properties.svn-base
geworkbench-core/classes/.svn/text-base/bioproc.anno.svn-base
geworkbench-core/classes/.svn/text-base/cellcomp.anno.svn-base
geworkbench-core/classes/.svn/text-base/client-config.wsdd.svn-base
geworkbench-core/classes/.svn/text-base/go.onto.svn-base
geworkbench-core/classes/.svn/text-base/jdic.properties.svn-base
geworkbench-core/classes/.svn/text-base/kegg.anno.svn-base
geworkbench-core/classes/.svn/text-base/kegg.onto.svn-base
geworkbench-core/classes/.svn/text-base/log4j.properties.svn-base
geworkbench-core/classes/.svn/text-base/manifest.svn-base
geworkbench-core/classes/.svn/text-base/molfunc.anno.svn-base
geworkbench-core/classes/.svn/text-base/yeast.syno.svn-base
geworkbench-core/classes/META-INF/MANIFEST.MF
geworkbench-core/classes/cruisecontrol/.svn/all-wcprops
geworkbench-core/classes/cruisecontrol/.svn/entries
geworkbench-core/classes/images/.svn/all-wcprops
geworkbench-core/classes/images/.svn/entries
geworkbench-core/classes/images/.svn/prop-base/Back.png.svn-base
geworkbench-core/classes/images/.svn/prop-base/ButtonClose.png.svn-base
geworkbench-core/classes/images/.svn/prop-base/Forward.png.svn-base
geworkbench-core/classes/images/.svn/prop-base/Reload.png.svn-base
geworkbench-core/classes/images/.svn/prop-base/Right.gif.svn-base
geworkbench-core/classes/images/.svn/prop-base/Stop.png.svn-base
geworkbench-core/classes/images/.svn/prop-base/back.gif.svn-base
geworkbench-core/classes/images/.svn/prop-base/down.gif.svn-base
geworkbench-core/classes/images/.svn/prop-base/forward.gif.svn-base
geworkbench-core/classes/images/.svn/prop-base/load.gif.svn-base
geworkbench-core/classes/images/.svn/prop-base/start.gif.svn-base
geworkbench-core/classes/images/.svn/prop-base/stop.gif.svn-base
geworkbench-core/classes/images/.svn/prop-base/up.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/Back.png.svn-base
geworkbench-core/classes/images/.svn/text-base/ButtonClose.png.svn-base
geworkbench-core/classes/images/.svn/text-base/Forward.png.svn-base
geworkbench-core/classes/images/.svn/text-base/Reload.png.svn-base
geworkbench-core/classes/images/.svn/text-base/Right.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/Stop.png.svn-base
geworkbench-core/classes/images/.svn/text-base/back.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/down.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/forward.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/load.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/start.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/stop.gif.svn-base
geworkbench-core/classes/images/.svn/text-base/up.gif.svn-base
geworkbench-core/classes/org/.svn/all-wcprops
geworkbench-core/classes/org/.svn/entries
geworkbench-core/classes/org/geworkbench/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/.svn/entries
geworkbench-core/classes/org/geworkbench/analysis/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/analysis/.svn/entries
geworkbench-core/classes/org/geworkbench/analysis/.svn/prop-base/AbstractAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/prop-base/AbstractGridAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/prop-base/AbstractSaveableParameterPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/AbstractAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/AbstractAnalysisGuiTest.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/AbstractAnalysisLabelComparator.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/AbstractAnalysisTest.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/AbstractGridAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/AbstractSaveableParameterPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/BaseAbstractAnalysisTest.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/HighlightCurrentParameterThread.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/ParameterKey.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/ReHighlightable.java.svn-base
geworkbench-core/classes/org/geworkbench/analysis/.svn/text-base/TestAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/algorithm/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/algorithm/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/algorithm/classification/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/algorithm/classification/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/algorithm/classification/.svn/prop-base/CSClassifier.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/algorithm/classification/.svn/prop-base/CSVisualClassifier.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/algorithm/classification/.svn/text-base/CSClassifier.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/algorithm/classification/.svn/text-base/CSVisualClassifier.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/prop-base/CSAnnotationContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/prop-base/CSAnnotationContextManager.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/prop-base/DSAnnotationContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/prop-base/DSAnnotationContextManager.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/text-base/CSAnnotationContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/text-base/CSAnnotationContextManager.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/text-base/DSAnnotationContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/annotation/.svn/text-base/DSAnnotationContextManager.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/AdjacencyMatrix.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/AdjacencyMatrixDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/CSAncillaryDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/CSDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/CSMarkerVector.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/DSAncillaryDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/DSDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/prop-base/GoAnalysisResult.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/AdjacencyMatrix.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/AdjacencyMatrixDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/CSAncillaryDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/CSDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/CSMarkerVector.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/DSAncillaryDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/DSDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/.svn/text-base/GoAnalysisResult.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/gsea/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/gsea/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/gsea/.svn/prop-base/CSGSEAResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/gsea/.svn/prop-base/DSGSEAResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/gsea/.svn/text-base/CSGSEAResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/gsea/.svn/text-base/DSGSEAResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/medusa/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/medusa/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/medusa/.svn/prop-base/MedusaDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/medusa/.svn/text-base/MedusaCommand.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/medusa/.svn/text-base/MedusaData.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/medusa/.svn/text-base/MedusaDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/microarrays/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/microarrays/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/microarrays/.svn/prop-base/CSMicroarraySet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/microarrays/.svn/prop-base/DSMicroarraySet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/microarrays/.svn/text-base/CSMicroarraySet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/microarrays/.svn/text-base/DSMicroarraySet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/pca/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/pca/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/pca/.svn/prop-base/CSPCADataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/pca/.svn/prop-base/DSPCADataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/pca/.svn/text-base/CSPCADataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/pca/.svn/text-base/DSPCADataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/sequences/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/sequences/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/sequences/.svn/prop-base/CSSequenceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/sequences/.svn/prop-base/DSSequenceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/sequences/.svn/text-base/CSSequenceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/sequences/.svn/text-base/DSSequenceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/prop-base/CSMicroarraySetView.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/prop-base/DSDataSetView.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/prop-base/DSMicroarraySetView.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/text-base/CSMicroarraySetView.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/text-base/DSDataSetView.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/biocollections/views/.svn/text-base/DSMicroarraySetView.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/prop-base/DSBioObject.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/prop-base/DSClassification.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/prop-base/DSPValued.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/prop-base/FoldChangeResult.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/prop-base/IdeaEdge.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/prop-base/IdeaProbeGene.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/prop-base/KMeansResultMarkers.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/DSBioObject.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/DSClassification.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/DSPValued.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/FoldChangeResult.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/IdeaEdge.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/IdeaGLoc.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/IdeaModule.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/IdeaNode.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/IdeaProbeGene.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/IdeaResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/KMeansResult.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/.svn/text-base/KMeansResultMarkers.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/prop-base/CSExpressionMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/prop-base/CSGeneMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/prop-base/DSGeneMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/prop-base/DSRangeMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/prop-base/SequenceMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/text-base/CSExpressionMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/text-base/CSGeneMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/text-base/DSGeneMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/text-base/DSRangeMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/.svn/text-base/SequenceMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/prop-base/APSerializable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/prop-base/AffyAnnotationParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/prop-base/AnnotationFields.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/prop-base/AnnotationManager.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/prop-base/AnnotationParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/prop-base/GeneOntologyUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/text-base/APSerializable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/text-base/AffyAnnotationParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/text-base/AnnotationFields.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/text-base/AnnotationManager.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/text-base/AnnotationParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/annotationparser/.svn/text-base/GeneOntologyUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/goterms/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/goterms/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/goterms/.svn/prop-base/GOTerm.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/goterms/.svn/prop-base/GeneOntologyTree.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/goterms/.svn/text-base/GOTerm.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/markers/goterms/.svn/text-base/GeneOntologyTree.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSAffyMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSAnovaResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSAnovaResultSetTest.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSExpressionMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSGenepixMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSMicroarray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSProbeIntensityArray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSSignificanceResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/CSTTestResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSAffyMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSAnovaResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSGenepixMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSMasterRagulatorResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSMicroarray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSMutableMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSProbeIntensityArray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSSignificanceResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/prop-base/DSTTestResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSAffyMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSAnovaResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSAnovaResultSetTest.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSExpressionMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSGenepixMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSMasterRegulatorResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSMasterRegulatorTableResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSMicroarray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSProbeIntensityArray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSSignificanceResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/CSTTestResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSAffyMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSAnovaResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSGenepixMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSMasterRagulatorResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSMasterRegulatorTableResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSMicroarray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSMutableMarkerValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSProbeIntensityArray.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSSignificanceResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/microarray/.svn/text-base/DSTTestResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/prop-base/BlastObj.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/prop-base/CSAlignmentResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/prop-base/CSSequence.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/prop-base/DSAlignmentResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/prop-base/DSSequence.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/text-base/BlastObj.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/text-base/CSAlignmentResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/text-base/CSSequence.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/text-base/DSAlignmentResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/sequence/.svn/text-base/DSSequence.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/prop-base/CSProteinStructure.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/prop-base/DSProteinStructure.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/prop-base/PudgeResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/prop-base/SkyLineResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/prop-base/SkybaseResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/text-base/CSProteinStructure.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/text-base/DSProteinStructure.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/text-base/MarkUsResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/text-base/PudgeResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/text-base/SkyLineResultDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/bioobjects/structure/.svn/text-base/SkybaseResultSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/prop-base/CSAnnotPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/prop-base/CSItemList.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/prop-base/CSPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/prop-base/CSSequentialItemList.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/prop-base/DSAnnotatedPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/prop-base/DSItemList.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/prop-base/DSPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/text-base/CSAnnotPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/text-base/CSItemList.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/text-base/CSPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/text-base/CSSequentialItemList.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/text-base/DSAnnotatedPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/text-base/DSItemList.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/panels/.svn/text-base/DSPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/prop-base/CSMatchedPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/prop-base/CSPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/prop-base/DSMatchedPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/prop-base/DSPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/prop-base/DSPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/prop-base/PatternDiscoveryParameters.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/prop-base/PatternResult.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/text-base/CSMatchedPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/text-base/CSPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/text-base/DSMatchedPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/text-base/DSPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/text-base/DSPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/text-base/PatternDiscoveryParameters.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/.svn/text-base/PatternResult.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/prop-base/CSMatrixReduceExperiment.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/prop-base/CSMatrixReduceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/prop-base/CSPValued.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/prop-base/CSPositionSpecificAffinityMatrix.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/prop-base/DSMatrixReduceExperiment.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/prop-base/DSMatrixReduceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/prop-base/DSPositionSpecificAffintyMatrix.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/text-base/CSMatrixReduceExperiment.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/text-base/CSMatrixReduceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/text-base/CSPValued.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/text-base/CSPositionSpecificAffinityMatrix.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/text-base/DSMatrixReduceExperiment.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/text-base/DSMatrixReduceSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/matrix/.svn/text-base/DSPositionSpecificAffintyMatrix.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/prop-base/CSSeqCmplxRegistration.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/prop-base/CSSeqPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/prop-base/CSSeqPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/prop-base/CSSeqRegistration.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/prop-base/DSMatchedSeqPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/prop-base/DSSeqPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/text-base/CSSeqCmplxRegistration.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/text-base/CSSeqPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/text-base/CSSeqPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/text-base/CSSeqRegistration.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/text-base/DSMatchedSeqPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/complex/pattern/sequence/.svn/text-base/DSSeqPatternMatch.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/CSExtendable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/CSUnigene.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSAnnotated.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSDescribable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSExtendable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSHasActivation.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSIdentifiable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSNamed.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSSequential.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/prop-base/DSUnigene.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/CSExtendable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/CSUnigene.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSAnnotated.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSDescribable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSExtendable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSHasActivation.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSIdentifiable.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSNamed.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSSequential.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/datastructure/properties/.svn/text-base/DSUnigene.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/model/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/AlgorithmExecutionResults.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/Analysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/AnalysisParameters.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/ClusteringAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/FilteringAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/NormalizingAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/ParamValidationResults.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/ParameterPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/ParameterPanelIncludingNormalized.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/prop-base/ProteinStructureAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/AlgorithmExecutionResults.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/Analysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/AnalysisParameters.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ClusteringAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/FilteringAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/NormalizingAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ParamValidationResults.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ParameterPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ParameterPanelIncludingNormalized.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ProteinAnnotationAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ProteinDatabaseAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ProteinSequenceAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/analysis/.svn/text-base/ProteinStructureAnalysis.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/AbstractCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/CSHierClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/CSSOMClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/Cluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/DSClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/DSHierClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/DSSOMClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/DefaultHierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/DefaultSOMCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/HierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/LeafSOMCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/MarkerHierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/MicroarrayHierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/NonRecursiveClusterSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/prop-base/SOMCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/AbstractCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/CSHierClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/CSSOMClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/Cluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/DSClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/DSHierClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/DSSOMClusterDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/DefaultHierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/DefaultSOMCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/HierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/LeafSOMCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/MarkerHierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/MicroarrayHierCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/NonRecursiveClusterSet.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/model/clusters/.svn/text-base/SOMCluster.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/prop-base/AffyParseContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/prop-base/AffymetrixParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/prop-base/GenePixParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/prop-base/GenepixParseContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/text-base/AffyParseContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/text-base/AffymetrixParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/text-base/GenePixParser.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/.svn/text-base/GenepixParseContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/prop-base/AbstractResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/prop-base/AffyResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/prop-base/EdgeListResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/prop-base/GenepixResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/prop-base/Resource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/text-base/AbstractResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/text-base/AffyResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/text-base/EdgeListResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/text-base/GenepixResource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/parsers/resources/.svn/text-base/Resource.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/util/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/util/.svn/prop-base/DSPValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/prop-base/Normal.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/prop-base/RandomNumberGenerator.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/prop-base/Range.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/prop-base/SequenceUtils.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/text-base/DSPValue.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/text-base/Normal.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/text-base/RandomNumberGenerator.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/text-base/Range.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/.svn/text-base/SequenceUtils.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/entries
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/prop-base/ColorContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/prop-base/DefaultColorContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/prop-base/ExpressionPValueColorContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/text-base/ColorContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/text-base/DefaultColorContext.java.svn-base
geworkbench-core/classes/org/geworkbench/bison/util/colorcontext/.svn/text-base/ExpressionPValueColorContext.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/DataSetNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/DataSetSaveNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/DataSetSubNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/DefaultIconAssignments.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/DownloadClient.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/FileOpenHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/Icons.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ImageData.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ImageFileFilter.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ImageNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/InformationPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/LoadDataDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/OboSourceDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/OboSourcePreference.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/PendingTreeNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/Phenotype16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ProjectNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ProjectPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ProjectPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ProjectSelection.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/ProjectTreeNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/RWspHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/RWspHelper.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/RegPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/RegisterBean.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/SaveFileFilterFactory.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/SaveTree.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/TreeNodeRenderer.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/UploadClient.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/WorkspaceHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/alignment16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/busy.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/busy_static.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/cel16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/chip16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/classifier16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/dendrogram16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/dna16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/edgelist.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/generic16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/image16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/network16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/pattern16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/project16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/projectPanelIcon.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/psam16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/significance16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/som16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/structure16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/prop-base/workspace16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/DataSetNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/DataSetSaveNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/DataSetSubNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/DefaultIconAssignments.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/DownloadClient.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/FileOpenHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/Icons.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/ImageData.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/ImageNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/InformationPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/LoadDataDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/OboSourceDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/OboSourcePreference.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/PDBDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/PendingTreeNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/Phenotype16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/ProjectNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/ProjectPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/ProjectPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/ProjectSelection.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/ProjectTreeNode.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/RWspHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/RWspHelper.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/RegPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/RegisterBean.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/SaveFileFilterFactory.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/SaveTree.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/TreeNodeRenderer.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/UploadClient.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/WorkspaceHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/alignment16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/busy.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/busy_static.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/cel16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/chip16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/classifier16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/dendrogram16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/dna16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/edgelist.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/generic16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/image16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/network16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/pattern16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/project16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/projectPanelIcon.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/psam16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/significance16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/som16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/structure16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/.svn/text-base/workspace16x16.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/.svn/prop-base/CommentsPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/.svn/prop-base/CommentsPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/.svn/text-base/CommentsPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/.svn/text-base/CommentsPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/prop-base/Dataset annotation.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/prop-base/User Comments.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/prop-base/annotationPanel.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/prop-base/annotationPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/prop-base/annotationPanelMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/prop-base/annotationPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/prop-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/text-base/Dataset annotation.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/text-base/User Comments.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/text-base/annotationPanel.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/text-base/annotationPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/text-base/annotationPanelMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/text-base/annotationPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/.svn/text-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/Dataset annotation_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/Dataset annotation_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/Dataset annotation_files/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/Dataset annotation_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/Dataset annotation_files/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/comments/help/Dataset annotation_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/prop-base/ExperimentInformationPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/prop-base/ExperimentInformationPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/prop-base/infoPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/prop-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/text-base/ExperimentInformationPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/text-base/ExperimentInformationPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/text-base/infoPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/.svn/text-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/prop-base/expInfo.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/prop-base/infoPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/prop-base/infoPanelMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/prop-base/infoPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/prop-base/infopanel.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/prop-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/text-base/expInfo.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/text-base/infoPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/text-base/infoPanelMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/text-base/infoPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/text-base/infopanel.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/.svn/text-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/infoPanel_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/infoPanel_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/infoPanel_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/infoPanel_files/.svn/prop-base/image002.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/infoPanel_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/experimentinformation/help/infoPanel_files/.svn/text-base/image002.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Affy File Matrix Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Affy File.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Affy MAS5_GCOS Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Delete Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Genepix Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Manage Project.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Manage Workspace.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Merge Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Open Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Project Folders Overview.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/ProjectPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/RMA Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/Rename Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/cell.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/preferences.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/projectPanel.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/projectPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/projectPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/prop-base/remote.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Affy File Matrix Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Affy File.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Affy MAS5_GCOS Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Delete Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Genepix Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Manage Project.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Manage Workspace.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Merge Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Open Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Project Folders Overview.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/ProjectPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/RMA Format.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/Rename Dataset.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/cell.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/preferences.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/projectPanel.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/projectPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/projectPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/.svn/text-base/remote.HTML.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/Manage_workspace_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/Manage_workspace_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/Manage_workspace_files/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/Manage_workspace_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/Manage_workspace_files/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/Manage_workspace_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/delete_dataset_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/delete_dataset_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/delete_dataset_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/delete_dataset_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/manage_projected_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/manage_projected_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/manage_projected_files/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/manage_projected_files/.svn/prop-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/manage_projected_files/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/manage_projected_files/.svn/text-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/merge_dataset_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/merge_dataset_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/merge_dataset_files/.svn/prop-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/merge_dataset_files/.svn/prop-base/image001.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/merge_dataset_files/.svn/text-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/merge_dataset_files/.svn/text-base/image001.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/prop-base/AffyFileMatrix.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/prop-base/RMAExpressFormat.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/prop-base/T_CEL_viewer.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/prop-base/affy.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/prop-base/affyMas5GcosFormat.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/prop-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/prop-base/image002.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/text-base/AffyFileMatrix.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/text-base/RMAExpressFormat.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/text-base/T_CEL_viewer.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/text-base/affy.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/text-base/affyMas5GcosFormat.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/text-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/open_dataset_files/.svn/text-base/image002.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/projects area_overviewed_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/projects area_overviewed_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/projects area_overviewed_files/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/projects area_overviewed_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/projects area_overviewed_files/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/projects area_overviewed_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/prop-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/prop-base/image001.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/prop-base/image002.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/text-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/text-base/image001.png.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/remote_files/.svn/text-base/image002.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/rename_dataset_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/rename_dataset_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/rename_dataset_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/rename_dataset_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/user preference_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/help/user preference_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/help/user preference_files/.svn/prop-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/help/user preference_files/.svn/text-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/prop-base/HistoryPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/prop-base/HistoryPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/prop-base/historyPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/text-base/HistoryPanel.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/text-base/HistoryPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/.svn/text-base/historyPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/prop-base/datasetHistory.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/prop-base/historyPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/prop-base/historyPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/prop-base/historyPanelMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/prop-base/historyPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/prop-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/text-base/datasetHistory.gif.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/text-base/historyPanel.htm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/text-base/historyPanelHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/text-base/historyPanelMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/text-base/historyPaneltoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/.svn/text-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/historyPanel_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/historyPanel_files/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/historyPanel_files/.svn/prop-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/historyPanel_files/.svn/text-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/images/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/images/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/images/.svn/prop-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/history/help/images/.svn/text-base/image001.jpg.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/prop-base/CaArrayFilteringDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/prop-base/RemoteResource.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/prop-base/RemoteResourceDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/prop-base/RemoteResourceManager.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/text-base/CaArrayFilteringDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/text-base/RemoteResource.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/text-base/RemoteResourceDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/.svn/text-base/RemoteResourceManager.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/carraydata/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/carraydata/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/carraydata/.svn/prop-base/CaArray2Experiment.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/remoteresources/carraydata/.svn/text-base/CaArray2Experiment.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/prop-base/Readme.txt.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/prop-base/test1.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/prop-base/test2.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/prop-base/test4.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/prop-base/test5.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/text-base/Readme.txt.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/text-base/test1.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/text-base/test2.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/text-base/test4.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/.svn/text-base/test5.wsp.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/target/Readme.txt
geworkbench-core/classes/org/geworkbench/builtin/projects/target/test1.wsp
geworkbench-core/classes/org/geworkbench/builtin/projects/target/test2.wsp
geworkbench-core/classes/org/geworkbench/builtin/projects/target/test4.wsp
geworkbench-core/classes/org/geworkbench/builtin/projects/target/test5.wsp
geworkbench-core/classes/org/geworkbench/builtin/projects/util/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/builtin/projects/util/.svn/entries
geworkbench-core/classes/org/geworkbench/builtin/projects/util/.svn/prop-base/CaARRAYPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/builtin/projects/util/.svn/text-base/CaARRAYPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/.svn/entries
geworkbench-core/classes/org/geworkbench/components/caarray/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/caarray/.svn/entries
geworkbench-core/classes/org/geworkbench/components/caarray/arraydata/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/caarray/arraydata/.svn/entries
geworkbench-core/classes/org/geworkbench/components/caarray/arraydata/.svn/prop-base/CaArray2Component.java.svn-base
geworkbench-core/classes/org/geworkbench/components/caarray/arraydata/.svn/text-base/CaArray2Component.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/components/caarray/arraydata/.svn/text-base/CaArray2Component.java.svn-base
geworkbench-core/classes/org/geworkbench/components/caarray/arraydata/.svn/text-base/CaArrayClient.java.svn-base
geworkbench-core/classes/org/geworkbench/components/caarray/arraydata/CaArray2Component.cwb.xml
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/prop-base/GenSpaceLogPreferences.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/prop-base/GenspaceLogger.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/prop-base/ObjectHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/prop-base/ObjectLogger.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/prop-base/XMLLoader.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/BrowserLauncher.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/FindJar.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/GenSpace.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/GenSpaceLogPreferences.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/GenSpaceMenu.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/GenSpaceMenu.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/GenSpaceServerFactory.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/GenspaceLogger.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/GenspaceLogger.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/ObjectHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/ObjectLogger.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/RealTimeWorkFlowSuggestion.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/RuntimeEnvironmentSettings.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/ServerConfig.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/TransactionElement.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/XMLLoader.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/text-base/login.conf.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/tmp/GenSpaceServerFactory.java.tmp
geworkbench-core/classes/org/geworkbench/components/genspace/.svn/tmp/ObjectLogger.java.tmp
geworkbench-core/classes/org/geworkbench/components/genspace/GenSpaceMenu.cwb.xml
geworkbench-core/classes/org/geworkbench/components/genspace/GenspaceLogger.cwb.xml
geworkbench-core/classes/org/geworkbench/components/genspace/bean/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/bean/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/bean/.svn/text-base/DomainUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/bean/.svn/text-base/RatingBean.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/chat/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/chat/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/chat/.svn/text-base/ChatReceiver.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/chat/.svn/text-base/ChatTest.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/chat/.svn/text-base/ScreenShareListener.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/chat/.svn/text-base/ScreenSharePublisher.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/genspace.HTML.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/genspace.jhm.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/genspaceHelpSet.hs.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/genspacetoc.xml.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/login.HTML.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/realtime_suggest.HTML.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/statistics.HTML.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/.svn/text-base/workflow_viz.HTML.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace.HTML
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace.jhm
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspaceHelpSet.hs
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/prop-base/realtime_suggest.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/prop-base/realtime_suggest_rate.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/prop-base/statistics.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/prop-base/workflow_viz_all.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/prop-base/workflow_viz_one.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/prop-base/workflow_viz_rate.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/text-base/realtime_suggest.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/text-base/realtime_suggest_rate.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/text-base/statistics.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/text-base/workflow_viz_all.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/text-base/workflow_viz_one.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/.svn/text-base/workflow_viz_rate.JPG.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/Thumbs.db
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/realtime_suggest.JPG
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/realtime_suggest_rate.JPG
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/statistics.JPG
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/workflow_viz_all.JPG
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/workflow_viz_one.JPG
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspace_files/workflow_viz_rate.JPG
geworkbench-core/classes/org/geworkbench/components/genspace/help/genspacetoc.xml
geworkbench-core/classes/org/geworkbench/components/genspace/help/login.HTML
geworkbench-core/classes/org/geworkbench/components/genspace/help/ncicb.css
geworkbench-core/classes/org/geworkbench/components/genspace/help/realtime_suggest.HTML
geworkbench-core/classes/org/geworkbench/components/genspace/help/statistics.HTML
geworkbench-core/classes/org/geworkbench/components/genspace/help/workflow_viz.HTML
geworkbench-core/classes/org/geworkbench/components/genspace/login.conf
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/prop-base/arrow_right.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/prop-base/empty.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/prop-base/full.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/prop-base/half.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/text-base/Star.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/text-base/StarRatingPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/text-base/WorkflowVisualizationPopup.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/text-base/arrow_right.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/text-base/empty.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/text-base/full.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/.svn/text-base/half.png.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/rating/arrow_right.png
geworkbench-core/classes/org/geworkbench/components/genspace/rating/empty.png
geworkbench-core/classes/org/geworkbench/components/genspace/rating/full.png
geworkbench-core/classes/org/geworkbench/components/genspace/rating/half.png
geworkbench-core/classes/org/geworkbench/components/genspace/server/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/server/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/server/wrapper/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/server/wrapper/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/server/wrapper/.svn/text-base/ToolWrapper.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/server/wrapper/.svn/text-base/UserWrapper.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/server/wrapper/.svn/text-base/WorkflowWrapper.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/AutoCompleteCombo.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/DataVisibility.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/GenSpaceGeneralProfile.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/GenSpaceLogin.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/GenSpaceRegistration.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/GenSpaceSecurityPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/NameRenderer.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/SocialNetworksHome.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/SocialTab.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/StatusBar.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/UpdateablePanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/WorkflowStatistics.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/WorkflowVisualization.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/WorkflowVisualizationPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/friendsTab.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/networksTab.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/privacyTab.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/profileTab.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/requestsTab.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/.svn/text-base/viewProfileTab.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/chat/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/ui/chat/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/ui/chat/.svn/text-base/ChatWindow.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/chat/.svn/text-base/RosterFrame.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/chat/.svn/text-base/ScreenSharingReceiver.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/graph/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/ui/graph/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/ui/graph/.svn/text-base/myGraph.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/ui/graph/.svn/text-base/myStackLayout.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/entries
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/text-base/DynamicTree.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/text-base/InboxTablePanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/text-base/RepositoryPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/text-base/WorkflowCommentsPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/text-base/WorkflowDetailsPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/text-base/WorkflowNode.java.svn-base
geworkbench-core/classes/org/geworkbench/components/genspace/workflowRepository/.svn/text-base/WorkflowRepository.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/EngineIcons.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/WelcomeScreen.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/analysisPlugin.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/commandArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/projectArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/selectionArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/visualArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/visualPlugin.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/prop-base/visualPluginGrey.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/EngineIcons.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/WelcomeScreen.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/analysisPlugin.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/commandArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/projectArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/selectionArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/visualArea.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/visualPlugin.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/.svn/text-base/visualPluginGrey.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/prop-base/ComponentConfigurationManager.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/prop-base/ComponentConfigurationManagerWindow.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/prop-base/PluginComponent.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/CCMTableModel.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/CCMTableModel2.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/ComponentConfigurationManager.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/ComponentConfigurationManager2.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/ComponentConfigurationManagerMenu.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/ComponentConfigurationManagerMenu.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/ComponentConfigurationManagerWindow.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/ComponentConfigurationManagerWindow2.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/DependencyManager.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/ccm/.svn/text-base/PluginComponent.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/config/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/Bean24.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/ComponentMetadata.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/GUIFramework.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/IdentifiableImpl.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/MenuItemInfo.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/MenuListener.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/PluginDescriptor.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/PluginRegistry.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/PreferencesMenu.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/PreferencesMenu.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/UILauncher.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/VisualMenu.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/VisualPlugin.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/Visualeye.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/Visualeye_Nonactive.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/default.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/prop-base/java.policy.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/Bean24.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/Closable.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/ComponentMetadata.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/GUIFramework.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/IdentifiableImpl.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/MenuItemInfo.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/MenuListener.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/PluginDescriptor.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/PluginRegistry.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/PreferencesMenu.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/PreferencesMenu.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/UILauncher.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/VisualMenu.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/VisualPlugin.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/Visualeye.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/Visualeye_Nonactive.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/default.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/.svn/text-base/java.policy.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/events/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/config/events/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/config/events/.svn/prop-base/Event.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/events/.svn/text-base/Event.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/DynamicMenuItemException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/GUIWindowObject.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/GeawConfigObject.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/GeawConfigRule.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/MalformedMenuItemException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/NotMenuListenerException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/NotVisualPluginException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/PluginObject.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/prop-base/PluginRule.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/DynamicMenuItemException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/GUIWindowObject.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/GeawConfigObject.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/GeawConfigRule.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/MalformedMenuItemException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/NotMenuListenerException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/NotVisualPluginException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/PluginObject.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/config/rules/.svn/text-base/PluginRule.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/help/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/help/.svn/prop-base/ccm.htm.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/prop-base/introduction.htm.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/prop-base/master.hs.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/prop-base/masterMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/prop-base/masterTOC.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/prop-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/text-base/ccm.htm.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/text-base/introduction.htm.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/text-base/master.hs.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/text-base/masterMap.jhm.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/text-base/masterTOC.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/.svn/text-base/ncicb.css.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/prop-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/prop-base/image002.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/prop-base/image003.jpg.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/prop-base/image004.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/prop-base/image005.jpg.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/text-base/image001.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/text-base/image002.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/text-base/image003.jpg.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/text-base/image004.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/caWorkbench introduction_files/.svn/text-base/image005.jpg.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/prop-base/CCM_GO_added.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/prop-base/CCM_Main.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/prop-base/CCM_adding_GO_dependency_check.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/prop-base/CCM_by_type.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/text-base/CCM_GO_added.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/text-base/CCM_Main.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/text-base/CCM_adding_GO_dependency_check.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/ccm_files/.svn/text-base/CCM_by_type.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/images/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/help/images/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/help/images/.svn/prop-base/fullGui.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/images/.svn/prop-base/image001.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/images/.svn/text-base/fullGui.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/help/images/.svn/text-base/image001.png.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/management/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/AcceptTypes.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/Asynchronous.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/ClassSearcher.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/ComponentClassLoader.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/ComponentObjectInputStream.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/ComponentRegistry.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/ComponentResource.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/Documentation.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/EventException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/Module.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/Overflow.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/Publish.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/Subscribe.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/SwingModel.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/SynchModel.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/Synchronous.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/prop-base/TypeMap.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/AcceptTypes.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/Asynchronous.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/ClassSearcher.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/ComponentClassLoader.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/ComponentObjectInputStream.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/ComponentRegistry.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/ComponentResource.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/Documentation.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/EventException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/Module.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/Overflow.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/Publish.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/Subscribe.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/SwingModel.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/SynchModel.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/Synchronous.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/management/.svn/text-base/TypeMap.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/ChoiceField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/DoubleField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/Field.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/FileField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/GlobalPreferences.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/Preferences.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/PreferencesDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/PreferencesManager.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/TextField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/prop-base/ValidationException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/ChoiceField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/DoubleField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/Field.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/FileField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/GlobalPreferences.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/IntegerField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/Preferences.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/PreferencesDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/PreferencesManager.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/TextField.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/preferences/.svn/text-base/ValidationException.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/properties/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/properties/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/properties/.svn/prop-base/PropertiesManager.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/properties/.svn/text-base/PropertiesManager.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/entries
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/Skin.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/blue_sphere.bmp.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/close.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/close_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/close_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/dock.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/dock_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/dock_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/max.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/max_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/max_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/min.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/min_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/min_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/undock.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/undock_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/prop-base/undock_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/ShortCutMenu.cwb.xml.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/ShortCutMenu.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/Skin.java.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/Thumbs.db.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/blue_sphere.bmp.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/close.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/close_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/close_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/dock.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/dock_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/dock_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/max.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/max_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/max_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/min.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/min_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/min_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/undock.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/undock_active.gif.svn-base
geworkbench-core/classes/org/geworkbench/engine/skin/.svn/text-base/undock_grey.gif.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/events/.svn/entries
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/AdjacencyMatrixCancelEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/AnalysisInvokedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/AnnotationsEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/CaArrayEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/CaArrayQueryEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/CaArrayRequestEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/CaArrayRequestHybridizationListEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/EventHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/FilteringEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/GeneSelectorEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/HierClusterModelEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/HierClusterModelEventListener.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ImageSnapshotEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/MarkerSelectedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/PendingNodeCancelledEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/PendingNodeLoadedFromWorkspaceEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/PhenotypeSelectedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/PhenotypeSelectorEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ProgressBarEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ProgressChangeEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ProjectEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ProjectNodeAddedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ProjectNodeAddedEventHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ProjectNodeRemovedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/ProjectNodeRenamedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/SingleMicroarrayEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/StatusBarEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/prop-base/SubpanelChangedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/AdjacencyMatrixCancelEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/AnalysisInvokedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/AnnotationsEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/CaArrayEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/CaArrayQueryEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/CaArrayRequestEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/CaArrayRequestHybridizationListEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/CaArrayReturnHybridizationListEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/CaArraySuccessEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/EventHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/FilteringEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/GeneSelectorEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/GeneTaggedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/HierClusterModelEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/HierClusterModelEventListener.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/HistoryEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ImageSnapshotEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/MarkerSelectedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/PendingNodeCancelledEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/PendingNodeLoadedFromWorkspaceEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/PhenotypeSelectedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/PhenotypeSelectorEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProgressBarEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProgressChangeEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProjectEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProjectNodeAddedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProjectNodeAddedEventHandler.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProjectNodePostCompletedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProjectNodeRemovedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/ProjectNodeRenamedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/SingleMicroarrayEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/StatusBarEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/.svn/text-base/SubpanelChangedEvent.java.svn-base
geworkbench-core/classes/org/geworkbench/events/listeners/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/events/listeners/.svn/entries
geworkbench-core/classes/org/geworkbench/events/listeners/.svn/prop-base/ProgressChangeListener.java.svn-base
geworkbench-core/classes/org/geworkbench/events/listeners/.svn/prop-base/StatusChangeListener.java.svn-base
geworkbench-core/classes/org/geworkbench/events/listeners/.svn/text-base/ParameterActionListener.java.svn-base
geworkbench-core/classes/org/geworkbench/events/listeners/.svn/text-base/ProgressChangeListener.java.svn-base
geworkbench-core/classes/org/geworkbench/events/listeners/.svn/text-base/StatusChangeListener.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/parsers/.svn/entries
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/AdjacencyMatrixFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/AffyFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/CELFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/DataSetFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/EdgeListFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/ExpressionFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/ExpressionResource.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/FileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/GenePixFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/GeoSeriesMatrixParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/InputFileFormatException.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/MageTabFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/MicroarraySetParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/PDBFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/PlatformChooser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/SOFTFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/SOFTSeriesParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/SampleFileParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/TabDelimitedDataMatrixFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/test.script.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/test2.script.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/prop-base/test3.script.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/AdjacencyMatrixFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/AffyFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/AffyFileFormatTest.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/CELFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/DataSetFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/DataSetFileFormatTest.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/EdgeListFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/ExpressionFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/ExpressionResource.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/FileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/GenePixFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/GeoSeriesMatrixParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/InputFileFormatException.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/MageTabFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/MicroarraySetParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/PDBFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/PatternFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/PlatformChooser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/SOFTFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/SOFTSeriesParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/SampleFileParser.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/TabDelimitedDataMatrixFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/test.script.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/test2.script.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/test3.script.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile1.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile2.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile3.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile4.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile5.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile6.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile7.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/.svn/text-base/testFile8.txt.svn-base
geworkbench-core/classes/org/geworkbench/parsers/sequences/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/parsers/sequences/.svn/entries
geworkbench-core/classes/org/geworkbench/parsers/sequences/.svn/prop-base/SequenceFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/sequences/.svn/prop-base/SequenceResource.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/sequences/.svn/text-base/SequenceFileFormat.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/sequences/.svn/text-base/SequenceResource.java.svn-base
geworkbench-core/classes/org/geworkbench/parsers/test.script
geworkbench-core/classes/org/geworkbench/parsers/test2.script
geworkbench-core/classes/org/geworkbench/parsers/test3.script
geworkbench-core/classes/org/geworkbench/parsers/testFile1.txt
geworkbench-core/classes/org/geworkbench/parsers/testFile2.txt
geworkbench-core/classes/org/geworkbench/parsers/testFile3.txt
geworkbench-core/classes/org/geworkbench/parsers/testFile4.txt
geworkbench-core/classes/org/geworkbench/parsers/testFile5.txt
geworkbench-core/classes/org/geworkbench/parsers/testFile6.txt
geworkbench-core/classes/org/geworkbench/parsers/testFile7.txt
geworkbench-core/classes/org/geworkbench/parsers/testFile8.txt
geworkbench-core/classes/org/geworkbench/util/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/.svn/entries
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/AffyAnnotationUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/BaseException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/BaseRuntimeException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/BinaryEncodeDecode.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/BrowserLauncher.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/BusySwingWorker.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ClassifierException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/Combinations.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/CommandBase.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/CorrelationDistance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/CsvFileFilter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/Debug.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/Distance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/EuclideanDistance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ImageFileFilter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ImageFileFilter.java.svn-base~HEAD
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/IndexSortComparator.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/JAutoList.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/OWFileChooser.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/PrintUtils.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ProgressBar.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ProgressBarT.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ProgressDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ProgressGraph.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ProgressItem.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/ProgressTask.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/PropertiesMonitor.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/QSort.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/RandomSequenceGenerator.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/RegularExpressionVerifier.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/SaveImage.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/SpearmanRankDistance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/SplashBitmap.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/TrainingProgressListener.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/TrainingTask.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/Util.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/prop-base/splashscreen.png.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/AffyAnnotationUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/BaseException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/BaseRuntimeException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/BasicAuthenticator.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/BinaryEncodeDecode.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/BrowserLauncher.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/BusySwingWorker.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ClassifierException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ColorScale.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/Combinations.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/CommandBase.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/CorrelationDistance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/CsvFileFilter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/Cursor.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/Debug.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/Distance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/EuclideanDistance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/FilePathnameUtils.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ImageFileFilter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/IndexSortComparator.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/JAutoList.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/OWFileChooser.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/PrintUtils.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ProgressBar.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ProgressBarT.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ProgressDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ProgressGraph.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ProgressItem.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ProgressTask.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/PropertiesMonitor.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/QSort.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/RandomSequenceGenerator.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/RegularExpressionVerifier.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ResultSetlUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/SaveImage.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/SpearmanRankDistance.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/SplashBitmap.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/TrainingProgressListener.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/TrainingTask.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/UnAuthenticatedException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/Util.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/ValidationUtils.java.svn-base
geworkbench-core/classes/org/geworkbench/util/.svn/text-base/splashscreen.png.svn-base
geworkbench-core/classes/org/geworkbench/util/annotation/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/annotation/.svn/entries
geworkbench-core/classes/org/geworkbench/util/annotation/.svn/prop-base/AffyAnnotationUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/util/annotation/.svn/prop-base/Pathway.java.svn-base
geworkbench-core/classes/org/geworkbench/util/annotation/.svn/text-base/AffyAnnotationUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/util/annotation/.svn/text-base/Pathway.java.svn-base
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/.svn/entries
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/cluster/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/cluster/.svn/entries
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/cluster/.svn/prop-base/CSMatrixPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/cluster/.svn/prop-base/DSMatrixPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/cluster/.svn/text-base/CSMatrixPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/cluster/.svn/text-base/DSMatrixPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/statistics/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/statistics/.svn/entries
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/statistics/.svn/prop-base/ClusterStatistics.java.svn-base
geworkbench-core/classes/org/geworkbench/util/associationdiscovery/statistics/.svn/text-base/ClusterStatistics.java.svn-base
geworkbench-core/classes/org/geworkbench/util/microarrayutils/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/microarrayutils/.svn/entries
geworkbench-core/classes/org/geworkbench/util/microarrayutils/.svn/prop-base/MicroarrayViewEventBase.java.svn-base
geworkbench-core/classes/org/geworkbench/util/microarrayutils/.svn/prop-base/MicroarrayVisualizer.java.svn-base
geworkbench-core/classes/org/geworkbench/util/microarrayutils/.svn/text-base/MicroarrayViewEventBase.java.svn-base
geworkbench-core/classes/org/geworkbench/util/microarrayutils/.svn/text-base/MicroarrayVisualizer.java.svn-base
geworkbench-core/classes/org/geworkbench/util/network/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/network/.svn/entries
geworkbench-core/classes/org/geworkbench/util/network/.svn/prop-base/CellularNetWorkElementInformation.java.svn-base
geworkbench-core/classes/org/geworkbench/util/network/.svn/text-base/CellularNetWorkElementInformation.java.svn-base
geworkbench-core/classes/org/geworkbench/util/network/.svn/text-base/CellularNetworkPreference.java.svn-base
geworkbench-core/classes/org/geworkbench/util/network/.svn/text-base/InteractionDetail.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/.svn/entries
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/.svn/prop-base/RankSorter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/.svn/text-base/RankSorter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/entries
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/Edge.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/EdgeList.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/EdgeListDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/MindyData.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/MindyDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/MindyGeneMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/NetBoostData.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/prop-base/NetBoostDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/Edge.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/EdgeList.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/EdgeListDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/MindyData.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/MindyDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/MindyGeneMarker.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/MindyResultRow.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/ModulatorInfo.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/ModulatorStatistics.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/NetBoostData.java.svn-base
geworkbench-core/classes/org/geworkbench/util/pathwaydecoder/mutualinformation/.svn/text-base/NetBoostDataSet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/entries
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/CSMatchedSeqPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/Pattern-ii.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/PatternFetchException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/PatternLocations.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/PatternOfflet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/PatternOperations.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/PatternSequenceDisplayUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/PatternSorter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/prop-base/pattern.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/CSMatchedSeqPattern.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/Pattern-ii.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/PatternFetchException.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/PatternLocations.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/PatternOfflet.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/PatternOperations.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/PatternSequenceDisplayUtil.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/PatternSorter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/patterns/.svn/text-base/pattern.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/entries
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/Back24.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/Forward24.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/GeneChromosomeMatcher.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/PatFilter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/PatternTableModel.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/PatternTableView.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/Sequence.jbx.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/SequenceViewWidget.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/SequenceViewWidgetPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/back.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/dna.GIF.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/prop-base/forward.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/Back24.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/Forward24.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/GeneChromosomeMatcher.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/PatFilter.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/PatternTableModel.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/PatternTableView.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/Sequence.jbx.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/SequenceViewWidget.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/SequenceViewWidgetPanel.java.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/back.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/dna.GIF.svn-base
geworkbench-core/classes/org/geworkbench/util/sequences/.svn/text-base/forward.gif.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/all-wcprops
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/entries
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/prop-base/JShapeButton.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/prop-base/JShapeDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/prop-base/PanelVisualProperties.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/prop-base/PanelVisualPropertiesManager.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/prop-base/VisualPropertiesDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/text-base/JShapeButton.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/text-base/JShapeDialog.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/text-base/PanelVisualProperties.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/text-base/PanelVisualPropertiesManager.java.svn-base
geworkbench-core/classes/org/geworkbench/util/visualproperties/.svn/text-base/VisualPropertiesDialog.java.svn-base
geworkbench-core/components/alignment/classes/org/geworkbench/components/alignment/panels/BlastViewComponent.cwb.xml~HEAD
geworkbench-core/components/analysis/classes/org/geworkbench/components/analysis/AnalysisPanel.cwb.xml~HEAD
geworkbench-core/components/genspace/src/org/geworkbench/components/genspace/.svn/tmp/GenSpaceServerFactory.java.tmp
geworkbench-core/components/genspace/src/org/geworkbench/components/genspace/.svn/tmp/ObjectLogger.java.tmp
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/.svn/prop-base/MarkerPanel.java.svn-base
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/.svn/prop-base/SequenceListRenderer.java.svn-base
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/.svn/prop-base/SequenceListSelectionListener.java.svn-base
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/.svn/text-base/MarkerPanel.java.svn-base
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/.svn/text-base/SequenceListRenderer.java.svn-base
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/.svn/text-base/SequenceListSelectionListener.java.svn-base
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/MarkerPanel.java
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/SequenceListRenderer.java
geworkbench-core/components/sequenceretriever/src/org/geworkbench/components/sequenceretriever/SequenceListSelectionListener.java
geworkbench-core/src/org/geworkbench/util/.svn/prop-base/ImageFileFilter.java.svn-base~HEAD
sql-scripts/genspace workflow rebuilding scripts.sql
diff --git a/genspace-common/disabled-src/msa/Alignment.java b/genspace-common/disabled-src/msa/Alignment.java
new file mode 100755
index 0000000..f01adca
--- /dev/null
+++ b/genspace-common/disabled-src/msa/Alignment.java
@@ -0,0 +1,109 @@
+package org.geworkbench.components.genspace.entity.msa;
+
+import java.io.Serializable;
+import java.util.Set;
+
+import javax.persistence.Basic;
+import javax.persistence.CascadeType;
+import javax.persistence.Column;
+import javax.persistence.Entity;
+import javax.persistence.FetchType;
+import javax.persistence.GeneratedValue;
+import javax.persistence.GenerationType;
+import javax.persistence.Id;
+import javax.persistence.Lob;
+import javax.persistence.ManyToMany;
+import javax.persistence.OneToMany;
+import javax.xml.bind.annotation.XmlElement;
+import javax.xml.bind.annotation.XmlRootElement;
+
+import org.geworkbench.components.genspace.entity.LazyCycleBreaker;
+
+@Entity
+@XmlRootElement
+public class Alignment extends LazyCycleBreaker implements Serializable {
+
+	private int id;
+
+	private String emblId;
+
+	private Set<ProteinSequence> sequences;
+
+	private String definition;
+
+	private String keywords;
+
+	private String comments;
+
+	private Set<Reference> references;
+
+	@Override
+	public String toString() {
+		return emblId;
+	}
+
+	@Id
+	@GeneratedValue(strategy=GenerationType.IDENTITY)
+	@XmlElement
+	public int getId() {
+		return id;
+	}
+
+	public void setId(int id) {
+		this.id = id;
+	}
+
+	@ManyToMany(mappedBy="alignments", cascade=CascadeType.ALL)
+	public Set<ProteinSequence> getSequences() {
+		return sequences;
+	}
+
+	public void setSequences(Set<ProteinSequence> sequences) {
+		this.sequences = sequences;
+	}
+
+	@Column(unique=true, nullable=false)
+	public String getEmblId() {
+		return emblId;
+	}
+
+	public void setEmblId(String emblId) {
+		this.emblId = emblId;
+	}
+
+	public String getDefinition() {
+		return definition;
+	}
+
+	public void setDefinition(String definition) {
+		this.definition = definition;
+	}
+
+	@Column(length=2000)
+	public String getKeywords() {
+		return keywords;
+	}
+
+	public void setKeywords(String keywords) {
+		this.keywords = keywords;
+	}
+
+	@Column(length=4000)
+	public String getComments() {
+		return comments;
+	}
+
+	public void setComments(String comments) {
+		this.comments = comments;
+	}
+
+	@OneToMany(mappedBy="alignment", cascade=CascadeType.ALL)
+	public Set<Reference> getReferences() {
+		return references;
+	}
+
+	public void setReferences(Set<Reference> references) {
+		this.references = references;
+	}
+
+}
diff --git a/genspace-common/disabled-src/msa/ProteinSequence.java b/genspace-common/disabled-src/msa/ProteinSequence.java
new file mode 100755
index 0000000..dce316f
--- /dev/null
+++ b/genspace-common/disabled-src/msa/ProteinSequence.java
@@ -0,0 +1,77 @@
+package org.geworkbench.components.genspace.entity.msa;
+
+import java.io.Serializable;
+import java.util.Set;
+
+import javax.persistence.CascadeType;
+import javax.persistence.Column;
+import javax.persistence.Entity;
+import javax.persistence.GeneratedValue;
+import javax.persistence.GenerationType;
+import javax.persistence.Id;
+import javax.persistence.ManyToMany;
+import javax.xml.bind.annotation.XmlElement;
+import javax.xml.bind.annotation.XmlRootElement;
+
+import org.geworkbench.components.genspace.entity.LazyCycleBreaker;
+
+@Entity
+@XmlRootElement
+public class ProteinSequence extends LazyCycleBreaker implements Serializable {
+
+	private int id;
+
+	private String accessionNo;
+	private String abbrevation;
+	private String description;
+	private String sequence;
+
+	private Set<Alignment> alignments;
+
+	@Id
+	@GeneratedValue(strategy=GenerationType.IDENTITY)
+	@XmlElement
+	public int getId() {
+		return id;
+	}
+	public void setId(int id) {
+		this.id = id;
+	}
+
+	@Column(unique=true, nullable=false)
+	public String getAccessionNo() {
+		return accessionNo;
+	}
+	public void setAccessionNo(String accessionNo) {
+		this.accessionNo = accessionNo;
+	}
+	public String getAbbrevation() {
+		return abbrevation;
+	}
+	public void setAbbrevation(String abbrevation) {
+		this.abbrevation = abbrevation;
+	}
+	public String getDescription() {
+		return description;
+	}
+	public void setDescription(String description) {
+		this.description = description;
+	}
+
+	@ManyToMany(cascade=CascadeType.ALL)
+	public Set<Alignment> getAlignments() {
+		return alignments;
+	}
+	public void setAlignments(Set<Alignment> alignments) {
+		this.alignments = alignments;
+	}
+
+	@Column(length=4000)
+	public String getSequence() {
+		return sequence;
+	}
+	public void setSequence(String sequence) {
+		this.sequence = sequence;
+	}
+
+}
diff --git a/genspace-common/disabled-src/msa/Reference.java b/genspace-common/disabled-src/msa/Reference.java
new file mode 100755
index 0000000..b726218
--- /dev/null
+++ b/genspace-common/disabled-src/msa/Reference.java
@@ -0,0 +1,71 @@
+package org.geworkbench.components.genspace.entity.msa;
+
+import java.io.Serializable;
+
+import javax.persistence.CascadeType;
+import javax.persistence.Entity;
+import javax.persistence.GeneratedValue;
+import javax.persistence.GenerationType;
+import javax.persistence.Id;
+import javax.persistence.ManyToOne;
+import javax.xml.bind.annotation.XmlElement;
+import javax.xml.bind.annotation.XmlRootElement;
+
+import org.geworkbench.components.genspace.entity.LazyCycleBreaker;
+
+@Entity
+@XmlRootElement
+public class Reference extends LazyCycleBreaker implements Serializable {
+
+	private int id;
+
+	private String title;
+
+	private String authors;
+
+	private String locator;
+
+	private Alignment alignment;
+
+	@Override
+	public String toString() {
+		return title + ", " + authors + ", " + locator;
+	}
+
+	@Id
+	@GeneratedValue(strategy=GenerationType.IDENTITY)
+	@XmlElement
+	public int getId() {
+		return id;
+	}
+	public void setId(int id) {
+		this.id = id;
+	}
+	public String getTitle() {
+		return title;
+	}
+	public void setTitle(String title) {
+		this.title = title;
+	}
+	public String getAuthors() {
+		return authors;
+	}
+	public void setAuthors(String authors) {
+		this.authors = authors;
+	}
+	public String getLocator() {
+		return locator;
+	}
+	public void setLocator(String locator) {
+		this.locator = locator;
+	}
+
+	@ManyToOne(cascade=CascadeType.ALL)
+	public Alignment getAlignment() {
+		return alignment;
+	}
+	public void setAlignment(Alignment alignment) {
+		this.alignment = alignment;
+	}
+
+}
diff --git a/genspace-common/src/org/geworkbench/components/genspace/entity/ToolStatCache.java b/genspace-common/src/org/geworkbench/components/genspace/entity/ToolStatCache.java
new file mode 100644
index 0000000..3c9164d
--- /dev/null
+++ b/genspace-common/src/org/geworkbench/components/genspace/entity/ToolStatCache.java
@@ -0,0 +1,49 @@
+package org.geworkbench.components.genspace.entity;
+
+import java.io.Serializable;
+import java.util.Date;
+
+import javax.persistence.Entity;
+import javax.persistence.Id;
+import javax.persistence.Temporal;
+import javax.persistence.TemporalType;
+
+@Entity
+public class ToolStatCache extends LazyCycleBreaker implements Serializable {
+	private int toolid;
+	private Tool mostPopularNext;
+	private Tool mostPopularBefore;
+	private Date updated;
+
+	@Override
+	public int getId() {
+		// TODO Auto-generated method stub
+		return toolid;
+	}
+	@Id
+	public int getToolid() {
+		return toolid;
+	}
+	public void setToolid(int toolid) {
+		this.toolid = toolid;
+	}
+	public Tool getMostPopularNext() {
+		return mostPopularNext;
+	}
+	public void setMostPopularNext(Tool mostPopularNext) {
+		this.mostPopularNext = mostPopularNext;
+	}
+	public Tool getMostPopularBefore() {
+		return mostPopularBefore;
+	}
+	public void setMostPopularBefore(Tool mostPopularBefore) {
+		this.mostPopularBefore = mostPopularBefore;
+	}
+	@Temporal(TemporalType.TIMESTAMP)
+	public Date getUpdated() {
+		return updated;
+	}
+	public void setUpdated(Date updated) {
+		this.updated = updated;
+	}
+}
diff --git a/genspace-ejb/src-disabled/msa/MSARecommender.java b/genspace-ejb/src-disabled/msa/MSARecommender.java
new file mode 100644
index 0000000..9b3ef55
--- /dev/null
+++ b/genspace-ejb/src-disabled/msa/MSARecommender.java
@@ -0,0 +1,254 @@
+package org.geworkbench.components.genspace.server.msa;
+
+import java.io.File;
+import java.io.FileReader;
+import java.io.IOException;
+import java.io.PrintWriter;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Collection;
+import java.util.HashMap;
+import java.util.HashSet;
+import java.util.LinkedHashSet;
+import java.util.List;
+import java.util.Map;
+import java.util.Set;
+import java.util.TreeSet;
+
+import javax.ejb.Stateless;
+import javax.jws.WebMethod;
+import javax.jws.WebService;
+import javax.persistence.EntityManager;
+import javax.persistence.PersistenceContext;
+import javax.persistence.TypedQuery;
+
+import org.geworkbench.components.genspace.entity.msa.Alignment;
+import org.geworkbench.components.genspace.entity.msa.ProteinSequence;
+
+import au.com.bytecode.opencsv.CSVReader;
+import blast.Hit;
+import blast.HitHsps;
+import blast.Hsp;
+
+@Stateless
+@WebService
+public class MSARecommender implements MSARecommenderLocal {
+
+	@PersistenceContext(unitName = "genspace_persist")
+	private EntityManager em;
+
+	public MSARecommender() {
+	}
+
+	@Override
+	@WebMethod
+	public List<ProteinSequence> getRecommendedSequences(List<ProteinSequence> queries) {
+		Map<String, List<Hit>> blastResult = null;
+		try {
+			StringBuilder sb = new StringBuilder();
+			for (ProteinSequence query : queries) {
+				sb.append(">").append(query.getAccessionNo()).append("\n")
+						.append(query.getSequence()).append("\n");
+			}
+			blastResult = runBlast(sb.toString());
+		} catch (Exception e) {
+			e.printStackTrace();
+			return new ArrayList<ProteinSequence>();
+		}
+
+		Map<Alignment, Set<String>> alignToQuery = new HashMap<Alignment, Set<String>>();
+		for (String query : blastResult.keySet()) {
+			Set<String> hitSeqs = new LinkedHashSet<String>();
+			for (Hit hit : blastResult.get(query)) {
+				hitSeqs.add(hit.getHitDef());
+			}
+
+			String sql = "SELECT DISTINCT a "
+					+ "FROM Alignment a JOIN a.sequences s "
+					+ "WHERE s.accessionNo in ("
+					+ listToString(hitSeqs, ",", true) + ")";
+			System.out.println(sql);
+			TypedQuery<Alignment> q = em.createQuery(sql, Alignment.class);
+
+			for (Alignment align : q.getResultList()) {
+				if (!alignToQuery.containsKey(align)) {
+					alignToQuery.put(align, new HashSet<String>());
+				}
+				alignToQuery.get(align).add(query);
+			}
+		}
+
+		List<ProteinSequence> result = new ArrayList<ProteinSequence>();
+		for (Alignment alignment : alignToQuery.keySet()) {
+			System.out.println("Alignment " + alignment.getEmblId() + " has "
+					+ alignment.getSequences().size() + " sequences");
+			for (ProteinSequence sequence : alignment.getSequences()) {
+				boolean isQuery = false;
+				for (ProteinSequence query : queries) {
+					if (compare(query.getSequence(), sequence.getSequence(), 0) > 99.9) {
+						isQuery = true;
+						break;
+					}
+				}
+				if (isQuery || result.contains(sequence)) {
+					continue;
+				}
+
+				result.add(sequence);
+			}
+		}
+
+		return result;
+	}
+
+	private float compare(String si, String sj, int start) {
+		int ilen = si.length() - 1;
+		int jlen = sj.length() - 1;
+
+		while (isGap(si.charAt(start + ilen))) {
+			ilen--;
+		}
+
+		while (isGap(sj.charAt(start + jlen))) {
+			jlen--;
+		}
+
+		int match = 0;
+		float pid = -1;
+
+		if (ilen > jlen) {
+			for (int j = 0; j < jlen; j++) {
+				if (si.substring(start + j, start + j + 1).equals(
+						sj.substring(start + j, start + j + 1))) {
+					match++;
+				}
+			}
+
+			pid = (float) match / (float) ilen * 100;
+		} else {
+			for (int j = 0; j < ilen; j++) {
+				if (si.substring(start + j, start + j + 1).equals(
+						sj.substring(start + j, start + j + 1))) {
+					match++;
+				}
+			}
+
+			pid = (float) match / (float) jlen * 100;
+		}
+
+		return pid;
+	}
+
+	private boolean isGap(char c) {
+		return (c == '-' || c == '.' || c == ' ') ? true : false;
+	}
+
+	private String listToString(Collection<?> sqlList, String delimiter,
+			boolean quote) {
+		StringBuilder constructedSQL = new StringBuilder();
+
+		for (Object subSQL : sqlList) {
+			if (quote) {
+				constructedSQL.append("\"");
+			}
+			constructedSQL.append(subSQL);
+			if (quote) {
+				constructedSQL.append("\"");
+			}
+			constructedSQL.append(delimiter);
+		}
+
+		if (sqlList.size() != 0) {
+			return constructedSQL.substring(0, constructedSQL.length()
+					- delimiter.length());
+
+		} else {
+			return "";
+		}
+	}
+
+	private Map<String, List<Hit>> runBlast(String query)
+			throws IOException {
+		String blastAllPath = "/Users/ningyu18/Downloads/COMS6901/FALL2011/ncbi-blast-2.2.25+/bin/blastp";
+		String blastDB = "/Users/ningyu18/gsc/projects/genspace/genspace-ejb/data/BlastDB/embl_align";
+
+		File infile = File.createTempFile("blast", ".fa");
+		File outfile = File.createTempFile("blast", ".csv");
+
+		PrintWriter out = new PrintWriter(infile);
+		out.println(query);
+		out.flush();
+		out.close();
+
+		ProcessBuilder pb = new ProcessBuilder(blastAllPath, "-task", "blastp",
+				"-db", blastDB, "-outfmt", "10", "-max_target_seqs", "1",
+				"-query", infile.getAbsolutePath(), "-out",
+				outfile.getAbsolutePath());
+		Process proc = pb.start();
+		try {
+			if (proc.waitFor() != 0) {
+				return new HashMap<String, List<Hit>>();
+			}
+		} catch (InterruptedException e) {
+			e.printStackTrace();
+			return new HashMap<String, List<Hit>>();
+		}
+		CSVReader reader = new CSVReader(new FileReader(outfile));
+
+		Map<String, List<Hit>> hits = new HashMap<String, List<Hit>>();
+		for (String[] line : reader.readAll()) {
+			String query_def = line[0];
+			if (!hits.containsKey(query_def)) {
+				hits.put(query_def, new ArrayList<Hit>());
+			}
+
+			Hit hit = new Hit();
+			hit.setHitDef(line[1].split("/")[0]);
+			Hsp hsp = new Hsp();
+			hsp.setHspEvalue(line[10]);
+			HitHsps hitHsps = new HitHsps();
+			hitHsps.getHsp().add(hsp);
+			hit.setHitHsps(hitHsps);
+
+			hits.get(query_def).add(hit);
+		}
+		reader.close();
+		return hits;
+		//
+		// outfile.delete();
+		// infile.delete();
+	}
+
+	public static void main(String[] args) {
+		try {
+			ProteinSequence query1 = new ProteinSequence();
+			query1.setAccessionNo("Z29573/1-768");
+			query1.setSequence("GCAAGTTTCCGCTACCCAGTGAGAATGCCCTTTAAGTCTTATAAATTAAGCAAAAGGAGCTGGTATCAGGCA"
+					+ "CACAAAATGTAGCCGATAACACCTTGCTTTACCACACCCCCACGGGAGACAGCAGTGATTAAAATTAAGCAA"
+					+ "TAAACGAAAGTTTGACTAAGTCATAATTTACATTAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCATAC"
+					+ "GATTAACCCAAATTAATAAATAACGGCGTAAAGAGTGTTTAAGTTATATACAAAAATAAAGTTAATAATTAA"
+					+ "CTAAACTGTAGCACGTTCTAGTTAATATTAAAATACATAATAAAAATGACTTTAATATCACCGACTACACGA"
+					+ "AAACTAAGACACAAACTGGGATTAGATACCCCACTATGCTTAGTAATAAACTAAAATAATTTAACAAACAAA"
+					+ "ATTATTCGCCAGAGAACTACTAGCAATTGCTTAAAACTCAAAGGACTTGGCGGTGCCCTAAACCCACCTAGA"
+					+ "GGAGCCTGTTCTATAATCGATAAACCCCGATAAACCAGACCTTATCTTGCCAATACAGCCTATATACCGCCA"
+					+ "TCGTCAGCTAACCTTTAAAAAGAATTACAGTAAGCAAAATCATACAACATAAAAACGTTAGGTCAAGGTGTA"
+					+ "GCATATGATAAGGAAAGTAATGGGCTACATTCTCTACTATAGAGCATAACGAATCATATTATGAAACTAAAA"
+					+ "TGCTTGAAGGAGGATTTAGTAGTAAATTAAGAATAGAGAGCTTAATTG\n");
+
+			List<ProteinSequence> recommendations = (new MSARecommender())
+					.getRecommendedSequences((Arrays
+							.asList(new ProteinSequence[] { query1 })));
+
+			for (ProteinSequence sequence : recommendations) {
+				System.out.print(sequence.getAccessionNo() + " matched ");
+//				System.out.print(listToString(recommendations.get(sequence),
+//						",", false));
+				System.out.println(" and appeared in "
+						+ sequence.getAlignments().size() + " alignments");
+			}
+
+		} catch (Exception e) {
+			e.printStackTrace();
+		}
+	}
+}
diff --git a/genspace-ejb/src-disabled/msa/MSARecommenderLocal.java b/genspace-ejb/src-disabled/msa/MSARecommenderLocal.java
new file mode 100644
index 0000000..c98e9c4
--- /dev/null
+++ b/genspace-ejb/src-disabled/msa/MSARecommenderLocal.java
@@ -0,0 +1,14 @@
+package org.geworkbench.components.genspace.server.msa;
+
+import java.util.List;
+
+import javax.ejb.Local;
+
+import org.geworkbench.components.genspace.entity.msa.ProteinSequence;
+
+@Local
+public interface MSARecommenderLocal {
+
+	public List<ProteinSequence> getRecommendedSequences(List<ProteinSequence> queries);
+
+}
diff --git a/geworkbench-core/classes/.svn/all-wcprops b/geworkbench-core/classes/.svn/all-wcprops
new file mode 100644
index 0000000..008cfbf
--- /dev/null
+++ b/geworkbench-core/classes/.svn/all-wcprops
@@ -0,0 +1,53 @@
+K 25
+svn:wc:ra_dav:version-url
+V 53
+/svn/geworkbench/!svn/ver/8493/trunk/geworkbench/conf
+END
+client-config.wsdd
+K 25
+svn:wc:ra_dav:version-url
+V 72
+/svn/geworkbench/!svn/ver/2201/trunk/geworkbench/conf/client-config.wsdd
+END
+jdic.properties
+K 25
+svn:wc:ra_dav:version-url
+V 69
+/svn/geworkbench/!svn/ver/5104/trunk/geworkbench/conf/jdic.properties
+END
+ConfigurationFile Schema.xsd
+K 25
+svn:wc:ra_dav:version-url
+V 84
+/svn/geworkbench/!svn/ver/1109/trunk/geworkbench/conf/ConfigurationFile%20Schema.xsd
+END
+all.xml
+K 25
+svn:wc:ra_dav:version-url
+V 61
+/svn/geworkbench/!svn/ver/8434/trunk/geworkbench/conf/all.xml
+END
+log4j.properties
+K 25
+svn:wc:ra_dav:version-url
+V 70
+/svn/geworkbench/!svn/ver/7925/trunk/geworkbench/conf/log4j.properties
+END
+Descriptor Schema.xsd
+K 25
+svn:wc:ra_dav:version-url
+V 77
+/svn/geworkbench/!svn/ver/6114/trunk/geworkbench/conf/Descriptor%20Schema.xsd
+END
+.cvsignore
+K 25
+svn:wc:ra_dav:version-url
+V 64
+/svn/geworkbench/!svn/ver/2683/trunk/geworkbench/conf/.cvsignore
+END
+application.properties
+K 25
+svn:wc:ra_dav:version-url
+V 76
+/svn/geworkbench/!svn/ver/8187/trunk/geworkbench/conf/application.properties
+END
diff --git a/geworkbench-core/classes/.svn/dir-prop-base b/geworkbench-core/classes/.svn/dir-prop-base
new file mode 100644
index 0000000..71fd28e
--- /dev/null
+++ b/geworkbench-core/classes/.svn/dir-prop-base
@@ -0,0 +1,6 @@
+K 10
+svn:ignore
+V 18
+configuration.xml
+
+END
diff --git a/geworkbench-core/classes/.svn/entries b/geworkbench-core/classes/.svn/entries
new file mode 100644
index 0000000..2579743
--- /dev/null
+++ b/geworkbench-core/classes/.svn/entries
@@ -0,0 +1,303 @@
+10
+
+dir
+8680
+https://ncisvn.nci.nih.gov/svn/geworkbench/trunk/geworkbench/conf
+https://ncisvn.nci.nih.gov/svn/geworkbench
+
+
+
+2011-11-04T21:12:29.393311Z
+8493
+zji
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+8b29bb6e-589a-435a-9a12-3ab907be3462
+
+client-config.wsdd
+file
+
+
+
+
+2012-01-10T18:25:38.000000Z
+55fbd4c6f381a12079f184b8dbbdf9db
+2007-01-11T15:24:36.000000Z
+2201
+keshav
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+6954
+
+jdic.properties
+file
+
+
+
+
+2011-08-17T00:10:46.000000Z
+7690eeda2362b576a4194f3b987ec36f
+2009-05-11T19:10:11.000000Z
+5104
+wangm
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+39
+
+ConfigurationFile Schema.xsd
+file
+
+
+
+
+2011-08-17T00:10:46.000000Z
+bfc038fcb40d61c20b0422c636abbfac
+2006-01-12T20:06:11.000000Z
+1109
+watkin
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+5861
+
+all.xml
+file
+
+
+
+
+2012-01-10T19:15:27.000000Z
+28104fc616ab64ae32280509e083f329
+2011-10-19T21:34:53.145523Z
+8434
+poddutun
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+3127
+
+log4j.properties
+file
+
+
+
+
+2011-08-17T00:19:06.000000Z
+0d8902552aed687e66fe82f456984b32
+2011-05-25T14:25:11.688972Z
+7925
+zji
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+898
+
+cruisecontrol
+dir
+
+Descriptor Schema.xsd
+file
+
+
+
+
+2011-08-17T00:10:46.000000Z
+f3895ec116d9797752da2ea5b20ce009
+2010-03-10T18:05:11.708079Z
+6114
+maz
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+9253
+
+.cvsignore
+file
+
+
+
+
+2011-08-17T00:10:46.000000Z
+1f0e698e6ea28e2e6f42e158c681f0e3
+2007-04-16T17:08:58.000000Z
+2683
+keshav
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+18
+
+application.properties
+file
+
+
+
+
+2011-08-17T00:19:06.000000Z
+5635338e1c9f8779f11defa4bb3ebe78
+2011-07-30T04:31:30.667242Z
+8187
+zji
+has-props
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+4419
+
diff --git a/geworkbench-core/classes/.svn/prop-base/.cvsignore.svn-base b/geworkbench-core/classes/.svn/prop-base/.cvsignore.svn-base
new file mode 100644
index 0000000..869ac71
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/.cvsignore.svn-base
@@ -0,0 +1,5 @@
+K 14
+svn:executable
+V 1
+*
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/ConfigurationFile Schema.xsd.svn-base b/geworkbench-core/classes/.svn/prop-base/ConfigurationFile Schema.xsd.svn-base
new file mode 100644
index 0000000..869ac71
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/ConfigurationFile Schema.xsd.svn-base
@@ -0,0 +1,5 @@
+K 14
+svn:executable
+V 1
+*
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/Descriptor Schema.xsd.svn-base b/geworkbench-core/classes/.svn/prop-base/Descriptor Schema.xsd.svn-base
new file mode 100644
index 0000000..869ac71
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/Descriptor Schema.xsd.svn-base
@@ -0,0 +1,5 @@
+K 14
+svn:executable
+V 1
+*
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/all.xml.svn-base b/geworkbench-core/classes/.svn/prop-base/all.xml.svn-base
new file mode 100644
index 0000000..869ac71
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/all.xml.svn-base
@@ -0,0 +1,5 @@
+K 14
+svn:executable
+V 1
+*
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/application.properties.svn-base b/geworkbench-core/classes/.svn/prop-base/application.properties.svn-base
new file mode 100644
index 0000000..869ac71
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/application.properties.svn-base
@@ -0,0 +1,5 @@
+K 14
+svn:executable
+V 1
+*
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/bioproc.anno.svn-base b/geworkbench-core/classes/.svn/prop-base/bioproc.anno.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/bioproc.anno.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/cellcomp.anno.svn-base b/geworkbench-core/classes/.svn/prop-base/cellcomp.anno.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/cellcomp.anno.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/client-config.wsdd.svn-base b/geworkbench-core/classes/.svn/prop-base/client-config.wsdd.svn-base
new file mode 100644
index 0000000..869ac71
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/client-config.wsdd.svn-base
@@ -0,0 +1,5 @@
+K 14
+svn:executable
+V 1
+*
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/go.onto.svn-base b/geworkbench-core/classes/.svn/prop-base/go.onto.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/go.onto.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/kegg.anno.svn-base b/geworkbench-core/classes/.svn/prop-base/kegg.anno.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/kegg.anno.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/kegg.onto.svn-base b/geworkbench-core/classes/.svn/prop-base/kegg.onto.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/kegg.onto.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/log4j.properties.svn-base b/geworkbench-core/classes/.svn/prop-base/log4j.properties.svn-base
new file mode 100644
index 0000000..869ac71
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/log4j.properties.svn-base
@@ -0,0 +1,5 @@
+K 14
+svn:executable
+V 1
+*
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/manifest.svn-base b/geworkbench-core/classes/.svn/prop-base/manifest.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/manifest.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/molfunc.anno.svn-base b/geworkbench-core/classes/.svn/prop-base/molfunc.anno.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/molfunc.anno.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/prop-base/yeast.syno.svn-base b/geworkbench-core/classes/.svn/prop-base/yeast.syno.svn-base
new file mode 100644
index 0000000..dbc918b
--- /dev/null
+++ b/geworkbench-core/classes/.svn/prop-base/yeast.syno.svn-base
@@ -0,0 +1,9 @@
+K 14
+svn:executable
+V 1
+*
+K 13
+svn:mime-type
+V 24
+application/octet-stream
+END
diff --git a/geworkbench-core/classes/.svn/text-base/.cvsignore.svn-base b/geworkbench-core/classes/.svn/text-base/.cvsignore.svn-base
new file mode 100644
index 0000000..61df1bd
--- /dev/null
+++ b/geworkbench-core/classes/.svn/text-base/.cvsignore.svn-base
@@ -0,0 +1 @@
+configuration.xml
diff --git a/geworkbench-core/classes/.svn/text-base/ConfigurationFile Schema.xsd.svn-base b/geworkbench-core/classes/.svn/text-base/ConfigurationFile Schema.xsd.svn-base
new file mode 100644
index 0000000..d58c4ba
--- /dev/null
+++ b/geworkbench-core/classes/.svn/text-base/ConfigurationFile Schema.xsd.svn-base
@@ -0,0 +1,118 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!-- edited with XMLSPY v2004 rel. 2 U (http://www.xmlspy.com) by Manjunath Kustagi (Columbia University) -->
+<xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" elementFormDefault="qualified" attributeFormDefault="unqualified">
+    <xs:element name="geaw-config">
+        <xs:annotation>
+            <xs:documentation>Top-level element.</xs:documentation>
+        </xs:annotation>
+        <xs:complexType>
+            <xs:sequence>
+                <xs:element name="description" type="xs:string" minOccurs="0" maxOccurs="1"/>
+                <xs:element name="gui-window" type="guiWindowRule"/>
+                <xs:element name="plugin" type="pluginRule" maxOccurs="unbounded"/>
+            </xs:sequence>
+        </xs:complexType>
+    </xs:element>
+    <xs:complexType name="pluginRule">
+        <xs:annotation>
+            <xs:documentation>A visual component</xs:documentation>
+        </xs:annotation>
+        <xs:sequence>
+            <xs:element name="extension-point" type="extensionPointRule" minOccurs="0" maxOccurs="unbounded"/>
+            <xs:element name="gui-area" type="guiAreaRule" minOccurs="0"/>
+            <xs:element name="use-module" type="moduleRule" minOccurs="0" maxOccurs="unbounded"/>
+            <xs:element name="subscription" type="subscriptionRule" minOccurs="0" maxOccurs="unbounded"/>
+        </xs:sequence>
+        <xs:attribute name="id" type="xs:ID" use="required">
+            <xs:annotation>
+                <xs:documentation>Inique identifier for the component</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="name" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>Display name for the component.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="source" type="xs:string" use="optional">
+            <xs:annotation>
+                <xs:documentation>Package source for the component.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="class" type="xs:anyURI" use="required">
+            <xs:annotation>
+                <xs:documentation>Pointer to the .class file for the visual compoent at hand.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+    <xs:complexType name="subscriptionRule">
+        <xs:annotation>
+            <xs:documentation>Description of a component subscription. Note that this is optional, missing subscription descriptors will be activated by default.</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="type" type="xs:anyURI" use="required">
+            <xs:annotation>
+                <xs:documentation>The URI pointing to the subscription type (its .class file) to which the plugin subscribes.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="enabled" type="yesNo" use="required">
+            <xs:annotation>
+                <xs:documentation>If set to 'yes', then the subscription is enabled, otherwise the subscription is disabled.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+    <xs:complexType name="extensionPointRule">
+        <xs:annotation>
+            <xs:documentation>The named area where a plugin is added</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="name" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>The name of the extension area where a component is added</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+    <xs:complexType name="moduleRule">
+        <xs:annotation>
+            <xs:documentation>The named area where a module is added</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="name" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>The name of the module (corresponding to the @Module method in the component).</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="id" type="xs:IDREF" use="required">
+            <xs:annotation>
+                <xs:documentation>The id of the plugin or this module.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+    <xs:complexType name="guiWindowRule">
+        <xs:annotation>
+            <xs:documentation>The top level application GUI window</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="name" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>The display name for the top level GUI window.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="class" type="xs:anyURI" use="required">
+            <xs:annotation>
+                <xs:documentation>Pointer to the class file for the implementation of the top level GUI window.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+    <xs:complexType name="guiAreaRule">
+        <xs:annotation>
+            <xs:documentation>Designates where a visual plugin is placed in the top level GUI</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="name" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>The name of a named visual area within a top lelel GUI window.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+    <xs:simpleType name="yesNo">
+        <xs:restriction base="xs:string">
+            <xs:enumeration value="Yes"/>
+            <xs:enumeration value="No"/>
+        </xs:restriction>
+    </xs:simpleType>
+</xs:schema>
diff --git a/geworkbench-core/classes/.svn/text-base/Descriptor Schema.xsd.svn-base b/geworkbench-core/classes/.svn/text-base/Descriptor Schema.xsd.svn-base
new file mode 100644
index 0000000..00de8af
--- /dev/null
+++ b/geworkbench-core/classes/.svn/text-base/Descriptor Schema.xsd.svn-base
@@ -0,0 +1,192 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!-- edited with XMLSPY v2004 rel. 2 U (http://www.xmlspy.com) by Manjunath Kustagi (Columbia University) -->
+<xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" elementFormDefault="qualified" attributeFormDefault="unqualified">
+    <xs:element name="component-descriptor">
+        <xs:annotation>
+            <xs:documentation>Top-level definition of the component descriptor.</xs:documentation>
+        </xs:annotation>
+        <xs:complexType>
+            	<xs:sequence>
+                	<xs:element name="component" type="componentRule" minOccurs="0" maxOccurs="unbounded"/>
+                	<xs:element name="plugin" type="pluginRule" minOccurs="0" maxOccurs="unbounded"/>
+            	</xs:sequence>
+        </xs:complexType>
+    </xs:element>
+
+    <xs:complexType name="componentRule">
+        <xs:annotation>
+            <xs:documentation>Describes the component.</xs:documentation>
+        </xs:annotation>
+        <xs:sequence>
+        	<xs:element name="required-component" type="requiredComponentRule" minOccurs="0" maxOccurs="unbounded"/>
+        	<xs:element name="related-component" type="relatedComponentRule" minOccurs="0" maxOccurs="unbounded"/>
+        	<xs:element name="license" type="xs:string" />
+            <xs:element name="menu-item" type="menuItemRule" minOccurs="0" maxOccurs="unbounded"/>
+            <xs:element name="online-help" type="helpRule" minOccurs="0"/>
+        </xs:sequence>
+        <xs:attribute name="class" type="xs:anyURI" use="required">
+            <xs:annotation>
+                <xs:documentation>Pointer to the .class file for the visual component.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="name" type="xs:string" use="optional">
+            <xs:annotation>
+                <xs:documentation>Common name of the component.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="icon" type="xs:string" use="optional">
+            <xs:annotation>
+                <xs:documentation>Pointer to the image file for the component's icon.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="version" type="xs:string" use="optional">
+            <xs:annotation>
+                <xs:documentation>The version number of this component.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+
+        <xs:attribute name="author" type="xs:string" use="optional">
+        </xs:attribute>
+        <xs:attribute name="authorURL" type="xs:anyURI" use="optional">
+        </xs:attribute>
+        <xs:attribute name="toolURL" type="xs:anyURI" use="optional">
+        </xs:attribute>
+        <xs:attribute name="tutorialURL" type="xs:anyURI" use="optional">
+        </xs:attribute>
+        <xs:attribute name="description" type="xs:string" use="optional">
+        </xs:attribute>
+        <xs:attribute name="analysis" type="xs:string" use="optional">
+        </xs:attribute>
+        <xs:attribute name="loadByDefault" type="xs:string" use="optional">
+        </xs:attribute>
+        <xs:attribute name="mustAccept" type="xs:string" use="optional">
+        </xs:attribute>
+        <xs:attribute name="documentation" type="xs:anyURI" use="optional">
+        </xs:attribute>
+        <xs:attribute name="visualizer" type="xs:string" use="optional">
+        </xs:attribute>
+        <xs:attribute name="hidden" type="xs:string" use="optional">
+        </xs:attribute>
+
+    </xs:complexType>
+
+    <xs:complexType name="pluginRule">
+        <xs:annotation>
+            <xs:documentation>Describes the plug in.</xs:documentation>
+        </xs:annotation>
+        <xs:sequence>
+        	<xs:element name="gui-area"  type="gui-areaRule" minOccurs="0" maxOccurs="unbounded"/>
+        </xs:sequence>
+        <xs:attribute name="id" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>id of the plug in.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="name" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>Common name of the plug in.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="class" type="xs:anyURI" use="required">
+            <xs:annotation>
+                <xs:documentation>Pointer to the .class file for the visual component.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="source" type="xs:string" use="optional">
+            <xs:annotation>
+                <xs:documentation>Pointer to the root folder of the plug in.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+
+    </xs:complexType>
+
+    <xs:complexType name="requiredComponentRule">
+    	<xs:annotation>
+            <xs:documentation>Indicates required components</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="class" type="xs:anyURI" use="required">
+    	</xs:attribute>
+    </xs:complexType>
+
+    <xs:complexType name="relatedComponentRule">
+    	<xs:annotation>
+            <xs:documentation>Indicates related components</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="class" type="xs:anyURI" use="required">
+    	</xs:attribute>
+    </xs:complexType>
+
+    <xs:complexType name="gui-areaRule">
+    	<xs:annotation>
+            <xs:documentation>Indicates visual area</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="VisualArea" type="xs:string" use="optional">
+    	</xs:attribute>
+    </xs:complexType>
+
+    <xs:complexType name="menuItemRule">
+        <xs:annotation>
+            <xs:documentation>Indicates a menu bar item</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="path" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>Indicates the full menu path for a menu item. E.g.
+"File.Open.Panel Set.Marker"
+Different levels are delineated by a dot (".").</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="icon" type="xs:anyURI" use="optional">
+            <xs:annotation>
+                <xs:documentation>Optional Icon to be associated with nenu item.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="accelerator" type="xs:string" use="optional">
+            <xs:annotation>
+                <xs:documentation>Optional short key combination to be associated with the menu item.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="mode" type="xs:token" use="required">
+            <xs:annotation>
+                <xs:documentation>Enumeration type, indicates when the controller listens to the designated menu item. Options are:
+
+"always"
+"onFocus": this is available only for controllers associated with visual components. Inidicates that the controller wants to be listening to a mwnu item only if the component has the focus.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="var" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>Contains a value that is passed as an argument to the method:
+                      MenuListener::getActionListener(String var)
+which is invoked on a plugin and returns an action listener for handling the menu item at hand.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+
+    <xs:complexType name="helpRule">
+        <xs:attribute name="helpSet" type="xs:anyURI" use="required">
+            <xs:annotation>
+                <xs:documentation>A URI pointing to the jar containing the actual collection of help files, namely:
+
+* helpSet: meta information designating the actual location of the remaining files in the archive.
+* map File: links help ids to the actaul content URLs (HTML pages, image, etc)
+* table of contents: listing of the topics (content tree) in the  help.
+* index: lists index ids/keyowrds to be shown in the index tab.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+        <xs:attribute name="parentId" type="xs:string" use="optional">
+            <xs:annotation>
+                <xs:documentation>The id of the component whose helpset file is the parent of this helpset file.</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+    <xs:complexType name="extensionPointRule">
+        <xs:annotation>
+            <xs:documentation>The named area where a plugin is added</xs:documentation>
+        </xs:annotation>
+        <xs:attribute name="name" type="xs:string" use="required">
+            <xs:annotation>
+                <xs:documentation>The name of the extension area where a component is added</xs:documentation>
+            </xs:annotation>
+        </xs:attribute>
+    </xs:complexType>
+</xs:schema>
diff --git a/geworkbench-core/classes/.svn/text-base/all.xml.svn-base b/geworkbench-core/classes/.svn/text-base/all.xml.svn-base
new file mode 100644
index 0000000..89dc1b6
--- /dev/null
+++ b/geworkbench-core/classes/.svn/text-base/all.xml.svn-base
@@ -0,0 +1,84 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<geaw-config xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
+	xsi:noNamespaceSchemaLocation="ConfigurationFile Schema.xsd">
+
+	<gui-window name="Main GUI" class="org.geworkbench.engine.skin.Skin" />
+
+    <plugin id="SoftFileFilter" name="soft. Format"
+		class="org.geworkbench.parsers.SOFTFileFormat" />
+
+	<plugin id="MageTabFileFilter" name="MAGE-TAB. Format"
+		class="org.geworkbench.parsers.MageTabFileFormat" />
+
+	<plugin id="expressionFileFilter" name="Exp. Format"
+		class="org.geworkbench.parsers.ExpressionFileFormat" />
+
+	<plugin id="pdbFileFilter" name="PDB Structure Format"
+		class="org.geworkbench.parsers.PDBFileFormat" />
+
+	<plugin id="projectWindow" name="Project Panel"
+		class="org.geworkbench.builtin.projects.ProjectPanel">
+		<gui-area name="ProjectArea" />
+	</plugin>
+
+	<plugin id="caarrayPanel" name="CaArray Panel"
+		class="org.geworkbench.builtin.projects.util.CaARRAYPanel">
+	</plugin>
+
+	<plugin id="WelcomeScreen" name="Welcome Screen"
+		class="org.geworkbench.engine.WelcomeScreen">
+		<gui-area name="VisualArea" />
+	</plugin>
+
+	<plugin id="configurationMenu" name="configurationMenu"
+		class="org.geworkbench.engine.ccm.ComponentConfigurationManagerMenu" />
+	<plugin id="preferences" name="preferences"
+		class="org.geworkbench.engine.config.PreferencesMenu" />
+
+	<plugin id="shortcuts" name="shortcuts"
+		class="org.geworkbench.engine.skin.ShortCutMenu" />
+
+	<plugin id="CELLoader" name="CEL File Loader"
+		class="org.geworkbench.parsers.CELFileFormat" />
+
+	<plugin id="affyFilter" name="Affy File Format"
+		class="org.geworkbench.parsers.AffyFileFormat" />
+
+	<plugin id="adjMatrixFilter" name="Addjacency Matrix File Format"
+		class="org.geworkbench.parsers.AdjacencyMatrixFileFormat" />
+
+	<plugin id="patFilter" name="Pattern File Format"
+		class="org.geworkbench.parsers.PatternFileFormat" />
+
+	<plugin id="sequenceFileFilter" name="FASTA Format"
+		class="org.geworkbench.parsers.sequences.SequenceFileFormat" />
+
+	<plugin id="genepixFilter" name="Genepix File Format"
+		class="org.geworkbench.parsers.GenePixFileFormat" />
+
+	<plugin id="tabDelimitedDataMatrixFileFilter" name="Tab-Delimited Data Matrix File Format"
+		class="org.geworkbench.parsers.TabDelimitedDataMatrixFileFormat" />
+
+	<!--
+	<plugin id="edgeListFilter" name="Edge List File Format"
+		class="org.geworkbench.components.parsers.EdgeListFileFormat" />
+
+	 -->
+
+	<plugin id="commentsPanel" name="Dataset Annotation"
+		class="org.geworkbench.builtin.projects.comments.CommentsPanel">
+	</plugin>
+	<plugin id="historyPanel" name="Dataset History"
+		class="org.geworkbench.builtin.projects.history.HistoryPanel">
+	</plugin>
+	<plugin id="infoPanel" name="Experiment Info"
+		class="org.geworkbench.builtin.projects.experimentinformation.ExperimentInformationPanel">
+	</plugin>
+
+	<!-- this must be after the three panels above -->
+	<plugin id="informationPanel" name="Information Panel"
+		class="org.geworkbench.builtin.projects.InformationPanel">
+		<gui-area name="VisualArea" />
+	</plugin>
+
+</geaw-config>
\ No newline at end of file
diff --git a/geworkbench-core/classes/.svn/text-base/application.properties.svn-base b/geworkbench-core/classes/.svn/text-base/application.properties.svn-base
new file mode 100644
index 0000000..660fa6f
--- /dev/null
+++ b/geworkbench-core/classes/.svn/text-base/application.properties.svn-base
@@ -0,0 +1,112 @@
+# The security policy for running the JVM needs to be modified for
+# performing caBIO queries
+java.security.policy=java.policy
+
+# Required for caBIO
+gov.nih.nci.caBIO.manager.dir=coreMgrDir.txt
+
+# Please modify to set path to your browser executable
+browser.path="C\:\\Program Files\\Internet Explorer\\IEXPLORE.EXE"
+
+# This is the file name where analyses parameter indices are stored
+analyses.parameter.file.name=parameterDB.index
+
+# This is the directory where temporary files are created
+temporary.files.directory=temp/GEAW
+
+# This is the application configuration file that the application will
+# default to if none is provided as a command line argument.
+component.configuration.file=all.xml
+
+# This has the Class definitions of components used in the application
+class.definition.file=class-def.xml
+
+# Directory where datafiles are stored that come with distribution, not for temporary files
+data.files.dir=data
+
+# URL where the master help set file is located. It is necessary that
+# this file is present, in order for the online help system to operate
+# properly. If this file is not found, then attempts to dynamically remove
+# components from the application (after the application has been started)
+# may incapacitate the online help.
+master.help.set=org/geworkbench/engine/help/master.hs
+
+# Flag to specify if the "exp" formatted expression dataset needs to
+# have a p-value column
+expressionMA.usePValue=false
+
+#Content of the File is a directory where datafiles are stored
+userSettings=userSettings.config
+
+#Content of the File is a directory where housekeeping genes config file is stored
+housekeepingnormalizerSettings=temp/GEAW/housekeepingnormalizerSettings.config
+# MySQL database Affy probes and GO bindings
+affy.data.manager.db=jdbc:mysql://localhost/c2b2pnp
+
+# The title string shown on the application framework
+application.title=geWorkbench {0} - An Open Extensible Platform for BioMedical Informatics
+application.version=Development
+
+# The URL where sequence alignment SOAP server located.
+sequence.server.endpoint=http://adparacel.cu-genome.org/axis/servlet/AxisServlet
+
+# The URL where columbia globus is located.
+globus.url=http://gridgate.genomecenter.columbia.edu:18080
+caarray.indexservice=/ogsa/services/edu/columbia/CaARRAYIndexService
+
+# The URL where dispatcher service is located.
+
+## production
+
+### nci
+
+## production URL for 2.2.1
+#indexServer.url=http://cagridnode.c2b2.columbia.edu:8080/v2.2.1/wsrf/services/DefaultIndexService
+#dispatcher.url=http://cagridnode.c2b2.columbia.edu:8080/v2.2.1/wsrf/services/cagrid/Dispatcher
+
+## luna
+#dispatcher.url=http://luna.bioc.columbia.edu:8081/wsrf/services/cagrid/Dispatcher
+#indexServer.url=http://luna.bioc.columbia.edu:8081/wsrf/services/DefaultIndexService
+
+## development
+indexServer.url=http://afdev.c2b2.columbia.edu:8080/wsrf/services/DefaultIndexService
+dispatcher.url=http://afdev.c2b2.columbia.edu:8080/wsrf/services/cagrid/Dispatcher
+
+#supported host types
+supported.host.type=splash blast
+
+# The responding Class name of QueryFactory for different server
+blast=org.geworkbench.util.session.server.BlastSessionQueryFactory
+splash=org.geworkbench.util.session.server.SplashSessionQueryFactory
+
+# caBIO stuff
+DefaultPersistenceManagerClass=REMOTE
+DefaultObjectManagerClass=REMOTE
+
+# Default utility file download site
+data.download.site=http://amdec-bioinfo.cu-genome.org/html/caWorkBench/data/
+
+# For dynamic instantiation of Expression Markers
+expression.marker.type=org.geworkbench.bison.datastructure.bioobjects.markers.CSExpressionMarker
+
+# For SOAP based ARACNe invocation
+aracne.nonmpi.host=reverse-eng.cu-genome.org
+aracne.mpi.host=reverse-eng-mpi.cu-genome.org
+
+# Axis SOAP URL that links to a web service to obtain Protein-Protein and Protein-DNA interactions in Human
+interactions.endpoint=http://interactions.cu-genome.org/axis/services/interactions
+
+#cnkb interactions servlet url
+interactions_servlet_url=http://cagridnode.c2b2.columbia.edu:8080/cknb/InteractionsServlet_new/InteractionsServlet
+
+# 3000 milliseconds
+interactions_servlet_connection_timeout=3000
+# reasonable number of interactions for create cytoscape network
+max_interaction_number=2000
+# Cnkb interaction flag. If value is set to 0, then draw pair interactions use cnkb version1 method.
+# If value is set to 1, the draw interactions use cnkb version2 method.
+interaction_flag=1
+
+
+# user setting directory
+user.setting.directory=.geworkbench
diff --git a/geworkbench-core/classes/.svn/text-base/bioproc.anno.svn-base b/geworkbench-core/classes/.svn/text-base/bioproc.anno.svn-base
new file mode 100644
index 0000000..355c8c7
--- /dev/null
+++ b/geworkbench-core/classes/.svn/text-base/bioproc.anno.svn-base
@@ -0,0 +1,8705 @@
+(species=Saccharomyces cerevisiae) (type=Biological Process) (curator=GO)
+YMR056C = 0006854
+YBR085W = 0006854
+YJR155W = 0006081
+YNL331C = 0006081
+YOL165C = 0006081
+YCR107W = 0006081
+YDL243C = 0006081
+YFL056C = 0006081
+YNL141W = 0006146
+Q0080 = 0015986
+YHR047C = 0000004
+YBL074C = 0006371
+YKL106W = 0006533
+YLR027C = 0006533
+YLR027C = 0006536
+YLR027C = 0006807
+YGL119W = 0006122
+YBR236C = 0006370
+YKL112W = 0045941
+YKL112W = 0006260
+YKL112W = 0006347
+YMR072W = 0000002
+YMR072W = 0000001
+YJR108W = 0000004
+YCR088W = 0000283
+YCR088W = 0000147
+YOR239W = 0030036
+YNR033W = 0046482
+YER045C = 0006367
+YGR037C = 0006631
+YGR037C = 0006631
+YNR016C = 0006633
+YNR016C = 0006998
+YLR131C = 0000114
+YLR144C = 0030036
+YJR083C = 0000004
+YBL015W = 0006084
+YBL015W = 0006083
+YDR511W = 0015978
+YDR511W = 0006094
+YLR304C = 0006099
+YLR304C = 0006101
+YLR304C = 0006537
+YLR304C = 0019541
+YKL192C = 0006633
+YAL054C = 0019654
+YAL054C = 0006085
+YLR153C = 0006085
+YFL039C = 0016288
+YFL039C = 0016288
+YFL039C = 0016288
+YFL039C = 0006887
+YFL039C = 0006897
+YFL039C = 0006970
+YFL039C = 0000011
+YFL039C = 0000011
+YFL039C = 0000132
+YFL039C = 0000132
+YFL039C = 0000001
+YFL039C = 0000001
+YFL039C = 0006887
+YFL039C = 0006887
+YFL039C = 0006897
+YFL039C = 0006897
+YFL039C = 0006970
+YFL039C = 0006970
+YFL039C = 0007047
+YFL039C = 0007047
+YFL039C = 0007118
+YFL039C = 0007118
+YFL039C = 0007119
+YFL039C = 0007119
+YFL039C = 0007119
+YFL039C = 0000283
+YFL039C = 0009306
+YFL039C = 0030050
+YFL039C = 0030037
+YFL039C = 0007151
+YFL039C = 0030037
+YFL039C = 0016573
+YFL039C = 0006357
+YDR448W = 0016568
+YDR448W = 0016573
+YAR015W = 0006144
+YAR015W = 0006144
+YNL220W = 0046086
+YLR359W = 0006144
+YLR028C = 0006189
+YLR028C = 0006189
+YLR028C = 0009060
+YLR028C = 0007151
+YMR120C = 0006189
+YMR120C = 0006189
+YOR128C = 0006144
+YOR128C = 0006144
+YGR204W = 0009113
+YMR300C = 0006144
+YMR300C = 0006144
+YGL234W = 0006144
+YGR061C = 0006164
+YDR408C = 0046084
+YOL086C = 0006113
+YMR303C = 0006067
+YMR303C = 0006113
+YMR083W = 0006113
+YGL256W = 0006113
+YBR145W = 0006066
+YMR318C = 0006081
+YMR318C = 0006066
+YCR105W = 0006066
+YDR226W = 0008283
+YER170W = 0000004
+YJR105W = 0006144
+YCR011C = 0006810
+YDR216W = 0006350
+YDR216W = 0007031
+YCR010C = 0006810
+YCR010C = 0019740
+YCR010C = 0007126
+YCR010C = 0006259
+YDL239C = 0007152
+YDL239C = 0006461
+YDL239C = 0030435
+YDL239C = 0030435
+YLR227C = 0030435
+YLR227C = 0030435
+YMR064W = 0006412
+YMR282C = 0006412
+YEL052W = 0000004
+YLR397C = 0042493
+YER017C = 0006461
+YER017C = 0006508
+YER017C = 0045041
+YDR085C = 0008277
+YDR085C = 0008277
+YDR085C = 0000750
+YDR085C = 0000750
+YDR085C = 0000750
+YPL202C = 0006367
+YPL202C = 0006367
+YPL202C = 0006979
+YPL202C = 0006979
+YPL202C = 0006879
+YPL202C = 0006879
+YNR044W = 0000752
+YNR044W = 0000752
+YGL032C = 0000752
+YDR524C = 0006888
+YDR524C = 0006888
+YDR524C = 0006891
+YDR524C = 0006891
+YIL044C = 0006888
+YIL044C = 0006888
+YIL044C = 0006891
+YIL044C = 0006891
+YCL025C = 0006865
+YBR132C = 0006631
+YBR132C = 0006970
+YFL055W = 0006865
+YDR214W = 0006457
+YDR214W = 0006457
+YDR214W = 0006950
+YDR214W = 0006950
+YDR214W = 0006950
+YOR023C = 0006337
+YLR109W = 0030503
+YLR109W = 0030503
+YHR093W = 0000004
+Q0050 = 0006397
+Q0050 = 0006315
+Q0050 = 0045333
+Q0055 = 0008380
+Q0060 = 0006371
+Q0065 = 0008380
+Q0070 = 0006316
+Q0075 = 0000004
+YMR092C = 0006970
+YMR092C = 0030042
+YMR092C = 0030042
+YIL079C = 0006406
+YDL175C = 0006406
+YBR059C = 0000004
+YDR264C = 0006897
+YDR264C = 0018318
+YDR264C = 0000750
+YOR034C = 0000004
+YOR335C = 0006419
+YOR335C = 0006419
+YMR170C = 0006519
+YMR169C = 0006950
+YOR374W = 0006067
+YER073W = 0008152
+YPL061W = 0005975
+YPL061W = 0006519
+YNL148C = 0007023
+YNL148C = 0007023
+YNL148C = 0007024
+YNL148C = 0007024
+YBR110W = 0006487
+YNL048W = 0006486
+YGL065C = 0006490
+YPL227C = 0006487
+YOR002W = 0006488
+YOR002W = 0006486
+YBR243C = 0006487
+YOR067C = 0006490
+YOR067C = 0006488
+YNL219C = 0006488
+YNL219C = 0006486
+YGL021W = 0000004
+YML086C = 0006979
+YNL270C = 0015802
+YOL130W = 0015674
+YOL130W = 0015674
+YOL130W = 0015693
+YFL050C = 0015674
+YFL050C = 0015674
+YFL050C = 0015693
+YGR225W = 0007127
+YGR225W = 0007127
+YGR225W = 0030163
+YGR225W = 0030163
+YGR225W = 0007151
+YML035C = 0006163
+YDR242W = 0000004
+YBR211C = 0007017
+YBR158W = 0000004
+YGL156W = 0005975
+YJR047C = 0006413
+YEL036C = 0006487
+YEL036C = 0006487
+YPR128C = 0006635
+YPR128C = 0006635
+YPR128C = 0006635
+YPR128C = 0006635
+YPR128C = 0007031
+YBR231C = 0000004
+YPR180W = 0016927
+YCL050C = 0009117
+YDR530C = 0009117
+YDR530C = 0009117
+YNL172W = 0000022
+YNL172W = 0006511
+YNL172W = 0007091
+YNL172W = 0000070
+YNL172W = 0008054
+YDL008W = 0000022
+YDL008W = 0006511
+YDL008W = 0007091
+YDL008W = 0000070
+YDL008W = 0008054
+YLR127C = 0000022
+YLR127C = 0006511
+YLR127C = 0007091
+YLR127C = 0000070
+YLR127C = 0008054
+YDR118W = 0000022
+YDR118W = 0006511
+YDR118W = 0007091
+YDR118W = 0000070
+YDR118W = 0008054
+YOR249C = 0000022
+YOR249C = 0006511
+YOR249C = 0007091
+YOR249C = 0000070
+YOR249C = 0008054
+YOR249C = 0006333
+YLR102C = 0000022
+YLR102C = 0006511
+YLR102C = 0007091
+YLR102C = 0000070
+YLR102C = 0008054
+YBR151W = 0000004
+YKL157W = 0006518
+YKL157W = 0006518
+YBR286W = 0007039
+YGL180W = 0006914
+YLL042C = 0006623
+YLL042C = 0006914
+YBR217W = 0006623
+YBR217W = 0006914
+YPR185W = 0006623
+YPR185W = 0006914
+YBR128C = 0006914
+YBR128C = 0006914
+YMR159C = 0006914
+YLR423C = 0006914
+YNL242W = 0006914
+YNL242W = 0006914
+YNL242W = 0006623
+YNL242W = 0006623
+YNL242W = 0030242
+YNL242W = 0030242
+YNL242W = 0030242
+YPL149W = 0006623
+YPL149W = 0006914
+YHR171W = 0006623
+YHR171W = 0006914
+YDL149W = 0000045
+YDL149W = 0006623
+YDL149W = 0006914
+YDR525W = 0000004
+YNL077W = 0000004
+YJR005W = 0016192
+YKL135C = 0016192
+YKL135C = 0016192
+YBL037W = 0016192
+YPR029C = 0016192
+YPR029C = 0016192
+YPL195W = 0006896
+YGR261C = 0006896
+YPL259C = 0016192
+YPL259C = 0016192
+YHL019C = 0016192
+YBR288C = 0006896
+YOL062C = 0006886
+YKL114C = 0006281
+YBL019W = 0006281
+YNL094W = 0030036
+YMR192W = 0000004
+YIL040W = 0000004
+YJL075C = 0000004
+YLR170C = 0016192
+YLR170C = 0016192
+YJR058C = 0016192
+YJL024C = 0006896
+YML022W = 0006167
+YDR441C = 0000004
+YNL065W = 0015893
+YNL065W = 0015718
+YBR043C = 0000004
+YPR192W = 0006833
+YLL052C = 0006833
+YBR149W = 0005975
+YBR149W = 0005975
+YGL105W = 0006409
+YGL105W = 0006418
+YIL062C = 0008151
+YLR370C = 0007015
+YKL013C = 0008151
+YNR035C = 0008151
+YBR234C = 0007015
+YHR013C = 0006473
+YCR048W = 0016125
+YNR019W = 0016125
+YDL192W = 0006888
+YDL192W = 0006888
+YDL192W = 0006891
+YDL192W = 0006891
+YDL137W = 0006888
+YDL137W = 0006888
+YDL137W = 0006891
+YDL137W = 0006891
+YOR094W = 0006886
+YOL058W = 0000052
+YOL058W = 0000053
+YOL058W = 0006526
+YJL071W = 0006592
+YJL088W = 0006526
+YJL088W = 0006591
+YHR018C = 0006526
+YER069W = 0006592
+YOL140W = 0006592
+YMR042W = 0045944
+YMR042W = 0006525
+YML099C = 0006525
+YML099C = 0045955
+YDR173C = 0016310
+YDR173C = 0006525
+YDR376W = 0006879
+YDR376W = 0006784
+YDR376W = 0006784
+YNL020C = 0016288
+YNL020C = 0000147
+YNL020C = 0006468
+YNL020C = 0006468
+YNL020C = 0007015
+YNL020C = 0007015
+YBR164C = 0016192
+YBR164C = 0016192
+YPL051W = 0006886
+YHL040C = 0015892
+YHL047C = 0009237
+YHL047C = 0006879
+YHL047C = 0015892
+YHL047C = 0015892
+YDR127W = 0009073
+YDR380W = 0006552
+YGL148W = 0009073
+YDR035W = 0009073
+YBR249C = 0009073
+YPR060C = 0009073
+YGL202W = 0009072
+YGL202W = 0009072
+YDR421W = 0006350
+YHR137W = 0009072
+YHR137W = 0009072
+YHR129C = 0000092
+YHR129C = 0000092
+YDR106W = 0000004
+YDL029W = 0007015
+YJR065C = 0007015
+YJL081C = 0006325
+YJL081C = 0006325
+YJL081C = 0006355
+YJL081C = 0016573
+YJL081C = 0006357
+YNL059C = 0006623
+YLR085C = 0006623
+YPR034W = 0006338
+YOR141C = 0000004
+YMR033W = 0006338
+YPR199C = 0045944
+YPR200C = 0046685
+YPR201W = 0015700
+YDL100C = 0000004
+YLR242C = 0015918
+YDR101C = 0000004
+YMR116C = 0000004
+YOR058C = 0007052
+YOR058C = 0000092
+YJL115W = 0008630
+YDL197C = 0006347
+YJL170C = 0000747
+YKL185W = 0007532
+YKL185W = 0007532
+YKL185W = 0007124
+YMR119W = 0006511
+YNL159C = 0006511
+YNL008C = 0006511
+YKL052C = 0000071
+YGR097W = 0006350
+YDL088C = 0000059
+YDL088C = 0006406
+YDL088C = 0006407
+YDL088C = 0006408
+YDL088C = 0006607
+YDL088C = 0006608
+YDL088C = 0006609
+YDL088C = 0006610
+YDL088C = 0006611
+YDL088C = 0006999
+YPR145W = 0006529
+YGR124W = 0006529
+YDR321W = 0006532
+YLR155C = 0006530
+YLR155C = 0006995
+YLR157C = 0006530
+YLR157C = 0006995
+YLR158C = 0006530
+YLR158C = 0006995
+YLR160C = 0006530
+YLR160C = 0006995
+YBL069W = 0006612
+YER101C = 0000004
+YDR184C = 0000004
+YGL017W = 0006464
+YGL017W = 0006511
+YGL017W = 0006511
+YOR377W = 0006113
+YGR177C = 0008202
+YPR026W = 0006950
+YPR026W = 0005993
+YPR026W = 0005993
+YPR026W = 0005993
+YPR026W = 0005993
+YMR301C = 0006879
+YDR384C = 0006810
+YDR384C = 0019740
+YBL099W = 0015986
+YBL099W = 0015986
+YLR393W = 0006461
+YNL315C = 0006461
+YNL315C = 0006461
+YJL180C = 0006461
+YJL180C = 0006461
+YLR295C = 0015986
+YLR295C = 0015986
+YPL271W = 0015986
+YPL271W = 0015986
+YPL271W = 0015986
+YDL004W = 0015986
+YDL004W = 0015986
+YDL004W = 0015986
+YDR377W = 0015986
+YDR377W = 0015986
+YML081C-A = 0015986
+YML081C-A = 0015986
+YML081C-A = 0015986
+YML081C-A = 0015986
+YOL077W-A = 0015986
+YOL077W-A = 0015986
+YJR121W = 0015986
+YJR121W = 0015986
+YJR121W = 0007574
+YPR020W = 0015986
+YPR020W = 0015986
+YPR020W = 0015986
+YPR020W = 0015986
+YBR039W = 0015986
+YPL078C = 0015986
+YPL078C = 0015986
+YDR298C = 0015986
+YDR298C = 0015986
+Q0085 = 0015986
+YKL016C = 0015986
+YKL016C = 0015986
+YML116W = 0006855
+YAL020C = 0007017
+YAL020C = 0007017
+YNL259C = 0006825
+YNL259C = 0006979
+YOR079C = 0030026
+YOR079C = 0030026
+YFL010W-A = 0006865
+YKL004W = 0006665
+YOR011W = 0015918
+YNR007C = 0006623
+YNR007C = 0006914
+YNR007C = 0006914
+YFR021W = 0007151
+YFR021W = 0007151
+YFR021W = 0007151
+YFR021W = 0006914
+YFR021W = 0006914
+YFR021W = 0006623
+YFR021W = 0006623
+YFR021W = 0006624
+YFR021W = 0006624
+YNL223W = 0006623
+YNL223W = 0006914
+YNL223W = 0006914
+YCL038C = 0006623
+YCL038C = 0006623
+YCL038C = 0006914
+YCL038C = 0006914
+YBL078C = 0006623
+YBL078C = 0006914
+YOL078W = 0001558
+YMR068W = 0001558
+YPR122W = 0007120
+YPR122W = 0000282
+YPR122W = 0000747
+YPR122W = 0000747
+YPR122W = 0007323
+YPR122W = 0007323
+YIL140W = 0007120
+YIL140W = 0000282
+YIL124W = 0006654
+YLL063C = 0019748
+YLL063C = 0019748
+YOR113W = 0006355
+YOR113W = 0006355
+YOR113W = 0009743
+YOR113W = 0009743
+YGR224W = 0006810
+YOR134W = 0007264
+YBR068C = 0006865
+YDR046C = 0006865
+YIL015W = 0030163
+YKR099W = 0009113
+YKR099W = 0009113
+YKR099W = 0000105
+YKR099W = 0000105
+YKR099W = 0006366
+YKR099W = 0006366
+YHR208W = 0009082
+YHR208W = 0009082
+YJR148W = 0009082
+YJR148W = 0009082
+YJL020C = 0030036
+YJL020C = 0030036
+YPL255W = 0007020
+YJL095W = 0006468
+YJL095W = 0007243
+YJL095W = 0007584
+YJL095W = 0000283
+YER167W = 0000074
+YDR361C = 0000004
+YDR375C = 0009060
+YIL033C = 0006950
+YIL033C = 0007124
+YIL033C = 0007165
+YIL033C = 0009408
+YLR399C = 0007151
+YDL070W = 0000004
+YAL060W = 0019650
+YNL039W = 0006384
+YBR200W = 0000753
+YBR200W = 0000753
+YBR200W = 0000753
+YBR200W = 0000283
+YER155C = 0007047
+YER155C = 0007117
+YER155C = 0007264
+YER155C = 0000283
+YER155C = 0030036
+YER155C = 0030036
+YER155C = 0000226
+YPL115C = 0007118
+YPL115C = 0007119
+YPL115C = 0007124
+YPL115C = 0007125
+YPL115C = 0007264
+YPL115C = 0000283
+YPL161C = 0007266
+YPL161C = 0000283
+YPL161C = 0030036
+YIL004C = 0006888
+YIL004C = 0006888
+YIL004C = 0006890
+YPR176C = 0018348
+YKR068C = 0006888
+YJL031C = 0018348
+YML077W = 0006888
+YJR053W = 0007094
+YJR053W = 0007094
+YJR053W = 0000747
+YOR198C = 0016288
+YOR198C = 0007051
+YOR198C = 0007088
+YOR198C = 0007117
+YOR198C = 0007126
+YDR299W = 0006888
+YGR282C = 0007047
+Q0110 = 0008380
+Q0115 = 0006371
+Q0115 = 0008380
+Q0120 = 0006372
+Q0120 = 0008380
+YHR101C = 0009272
+YHR101C = 0009272
+YCL029C = 0007052
+YCL029C = 0000092
+YER016W = 0000065
+YER016W = 0007019
+YER016W = 0007020
+YER016W = 0007026
+YER016W = 0007094
+YGR286C = 0009102
+YNR058W = 0009102
+YNR058W = 0009102
+YNR057C = 0009102
+YNR057C = 0009102
+YNR056C = 0009102
+YNR056C = 0015875
+YNR056C = 0015875
+YJR089W = 0007059
+YJL058C = 0000004
+YFL007W = 0000004
+YER177W = 0007124
+YER177W = 0007151
+YER177W = 0007265
+YER177W = 0000193
+YER177W = 0005977
+YDR099W = 0007124
+YDR099W = 0007151
+YDR099W = 0007265
+YDR099W = 0000193
+YDR099W = 0005977
+YPL217C = 0006364
+YPL217C = 0042255
+YPL217C = 0006365
+YJR025C = 0009435
+YJR078W = 0009435
+YJL060W = 0009435
+YBL098W = 0009435
+YLR231C = 0009435
+YLR231C = 0009435
+YFR047C = 0009435
+YFR047C = 0009435
+YNL271C = 0000132
+YNL271C = 0006970
+YNL271C = 0007015
+YNL271C = 0007117
+YNL271C = 0007121
+YNL271C = 0007266
+YNL271C = 0000283
+YNL271C = 0000283
+YNL271C = 0008298
+YNL233W = 0016288
+YNL166C = 0000094
+YNL166C = 0000094
+YNL166C = 0000094
+YNL166C = 0016288
+YIL159W = 0007015
+YIL159W = 0006970
+YIL159W = 0007120
+YGR230W = 0007126
+YBL085W = 0007266
+YBL085W = 0007266
+YBL085W = 0000283
+YBL085W = 0000283
+YBL085W = 0000283
+YER114C = 0007266
+YER114C = 0007266
+YER114C = 0000283
+YER114C = 0000283
+YER114C = 0000283
+YPL221W = 0000004
+YLR267W = 0000004
+YNL042W = 0000004
+YLR078C = 0006888
+YCR032W = 0009268
+YDL141W = 0006464
+YLL015W = 0015723
+YLL015W = 0015723
+YLL015W = 0015691
+YDL074C = 0006810
+YDL074C = 0006810
+YLR015W = 0006350
+YLR015W = 0006348
+YLR015W = 0016571
+YDL231C = 0006897
+YNR051C = 0000004
+YGR246C = 0006384
+YBL097W = 0007076
+YBL097W = 0007076
+YBL097W = 0007076
+YBL097W = 0007076
+YBL097W = 0000070
+YPL084W = 0007165
+YPL084W = 0006511
+YPR057W = 0000245
+YER172C = 0006372
+YGL247W = 0006998
+YGL247W = 0006406
+YGL247W = 0006611
+YOL077C = 0000027
+YBR290W = 0006823
+YBR290W = 0006623
+YFL025C = 0016050
+YFL025C = 0016050
+YFL025C = 0030433
+YGR142W = 0006885
+YGR142W = 0006885
+YPL069C = 0016114
+YPL069C = 0016114
+YPL069C = 0016114
+YDR252W = 0006444
+YGR188C = 0007094
+YMR055C = 0007094
+YMR055C = 0007094
+YOR026W = 0007094
+YGL174W = 0000282
+YAR014C = 0000282
+YAR014C = 0030447
+YEL029C = 0000282
+YNR027W = 0000282
+YJL188C = 0000282
+YKL092C = 0007120
+YKL092C = 0007120
+YKL092C = 0007121
+YKL092C = 0007121
+YKL092C = 0007264
+YKL092C = 0000282
+YLR074C = 0000282
+YOR078W = 0030490
+YOR078W = 0030490
+YMR014W = 0000282
+YCR047C = 0000282
+YER014C-A = 0000282
+YDR241W = 0000282
+YFL023W = 0000282
+YLR062C = 0000282
+YCL014W = 0016288
+YCL014W = 0007120
+YCL014W = 0000282
+YDL151C = 0000282
+YCR063W = 0000282
+YGR262C = 0000282
+YGR262C = 0006468
+YJR092W = 0007120
+YJR092W = 0000282
+YCR038C = 0007120
+YCR038C = 0007120
+YCR038C = 0007120
+YCR038C = 0007121
+YCR038C = 0007121
+YCR038C = 0007121
+YCR038C = 0007124
+YCR038C = 0007264
+YCR038C = 0000282
+YLR319C = 0016288
+YLR319C = 0006970
+YLR319C = 0007015
+YLR319C = 0007121
+YLR319C = 0007266
+YLR319C = 0000282
+YLR319C = 0000282
+YLR319C = 0000283
+YLR319C = 0000283
+YOR299W = 0000282
+YLR353W = 0007124
+YLR353W = 0000282
+YGR041W = 0000282
+YMR275C = 0000001
+YMR275C = 0000209
+YMR275C = 0000209
+YMR275C = 0006513
+YMR275C = 0006513
+YML111W = 0000209
+YML111W = 0000209
+YML111W = 0006513
+YML111W = 0006513
+YLR226W = 0000070
+YLR226W = 0006350
+YLR226W = 0006350
+YLR226W = 0006350
+YER159C = 0000122
+YER159C = 0000122
+YHR114W = 0007015
+YHR114W = 0009651
+YHR114W = 0009651
+YML102W = 0006334
+YML102W = 0006281
+YML102W = 0006342
+YDR423C = 0046686
+YDR423C = 0045944
+YNL278W = 0006357
+YGR134W = 0006357
+YFL028C = 0006355
+YFL028C = 0006355
+YJR122W = 0000004
+YOR276W = 0016478
+YOR276W = 0016478
+YKR036C = 0006355
+YKR036C = 0006355
+YKR036C = 0006355
+YNL288W = 0006357
+YER048C = 0000004
+YFL029C = 0007049
+YFL029C = 0006468
+YFL029C = 0007126
+YFL029C = 0007126
+YPL048W = 0006448
+YPL048W = 0006448
+YEL063C = 0015802
+YKL007W = 0006897
+YKL007W = 0006970
+YKL007W = 0007015
+YKL007W = 0007047
+YIL034C = 0006897
+YIL034C = 0006970
+YIL034C = 0007015
+YIL034C = 0007047
+YPL111W = 0019547
+YLR438W = 0006527
+YML042W = 0009437
+YOR125C = 0006743
+YMR280C = 0006094
+YMR280C = 0045944
+YGR036C = 0006487
+YGR036C = 0008610
+YGR036C = 0008610
+YPL178W = 0006371
+YJR060W = 0009086
+YJR060W = 0000067
+YGR140W = 0007059
+YLR175W = 0000154
+YLR175W = 0006365
+YNL161W = 0000749
+YNL161W = 0000753
+YNL161W = 0007096
+YNL161W = 0030012
+YJL209W = 0006402
+YJL209W = 0009060
+YHL038C = 0008380
+YPL215W = 0006461
+YGR174C = 0006461
+YBR120C = 0006412
+YIL043C = 0006118
+YDL069C = 0006412
+YDR197W = 0006412
+YKL208W = 0017004
+YKL208W = 0017004
+YKL208W = 0006397
+YKL208W = 0006397
+YER168C = 0006400
+YLR220W = 0006874
+YLR220W = 0006874
+YLR220W = 0006879
+YLR220W = 0006879
+YLR220W = 0030026
+YLR220W = 0030026
+YDR270W = 0006825
+YDR270W = 0015680
+YKL011C = 0006310
+YGR217W = 0006816
+YPR025C = 0006367
+YPR025C = 0006367
+YPR025C = 0007070
+YKR066C = 0006979
+YAL021C = 0006357
+YAL021C = 0000289
+YIL142W = 0006457
+YIL142W = 0007010
+YJL014W = 0006457
+YJL014W = 0007010
+YDL143W = 0006457
+YDL143W = 0007010
+YJR064W = 0006457
+YJR064W = 0007010
+YDR188W = 0006457
+YDR188W = 0007010
+YJL111W = 0006457
+YJL111W = 0007010
+YJL008C = 0006457
+YJL008C = 0007010
+YLR110C = 0000747
+YLR110C = 0000752
+YLR110C = 0007047
+YLR390W-A = 0007047
+YLR390W-A = 0007047
+YBR131W = 0007034
+YBR131W = 0007034
+YBR131W = 0006914
+YBR131W = 0000046
+YLR307W = 0007152
+YLR307W = 0007152
+YLR308W = 0007152
+YLR308W = 0007152
+YDR182W = 0006310
+YDR182W = 0006875
+YDR182W = 0006875
+YDR182W = 0006875
+YDR182W = 0007103
+YDR182W = 0007117
+YDR182W = 0000747
+YDR182W = 0030026
+YCR002C = 0000902
+YCR002C = 0016288
+YCR002C = 0007047
+YCR002C = 0007120
+YCR002C = 0007121
+YCR002C = 0007152
+YCR002C = 0000747
+YCR002C = 0000753
+YCR002C = 0000283
+YJR076C = 0000902
+YJR076C = 0016288
+YJR076C = 0007047
+YJR076C = 0007120
+YJR076C = 0000747
+YJR076C = 0000283
+YHR107C = 0000902
+YHR107C = 0016288
+YHR107C = 0007047
+YHR107C = 0007120
+YHR107C = 0007121
+YHR107C = 0000747
+YHR107C = 0000283
+YLR215C = 0000004
+YDL220C = 0016233
+YDL220C = 0000723
+YFR028C = 0006261
+YFR028C = 0006470
+YFR028C = 0007096
+YFR028C = 0007096
+YAR019C = 0016288
+YAR019C = 0007096
+YAR019C = 0006468
+YKL022C = 0000022
+YKL022C = 0006511
+YKL022C = 0007091
+YKL022C = 0000070
+YKL022C = 0008054
+YAL038W = 0006090
+YAL038W = 0006096
+YDL102W = 0006272
+YDL102W = 0006273
+YDL102W = 0006280
+YDL102W = 0006284
+YDL102W = 0006289
+YDL102W = 0006298
+YDL102W = 0006298
+YDL102W = 0006301
+YGL116W = 0000022
+YGL116W = 0006511
+YGL116W = 0007091
+YGL116W = 0000070
+YGL116W = 0008054
+YOR074C = 0006231
+YOR074C = 0006261
+YHR166C = 0000022
+YHR166C = 0006511
+YHR166C = 0007091
+YHR166C = 0000070
+YHR166C = 0008054
+YAL041W = 0006033
+YAL041W = 0007118
+YAL041W = 0007119
+YAL041W = 0007124
+YAL041W = 0007125
+YAL041W = 0007264
+YAL041W = 0000753
+YAL041W = 0000753
+YAL041W = 0000283
+YAL041W = 0000750
+YAL041W = 0000750
+YAL041W = 0000750
+YLR310C = 0007265
+YLR310C = 0000074
+YLR310C = 0007089
+YFR036W = 0000022
+YFR036W = 0006511
+YFR036W = 0007091
+YFR036W = 0000070
+YFR036W = 0008054
+YBL084C = 0000022
+YBL084C = 0006511
+YBL084C = 0007091
+YBL084C = 0000070
+YBL084C = 0008054
+YBR160W = 0000086
+YBR160W = 0000074
+YBR160W = 0000082
+YBR160W = 0000084
+YBR160W = 0040020
+YLR314C = 0000902
+YLR314C = 0016288
+YLR314C = 0007047
+YLR314C = 0007120
+YLR314C = 0000283
+YOR257W = 0007020
+YOR257W = 0007103
+YOL139C = 0006413
+YOL139C = 0006413
+YOL139C = 0000074
+YDR054C = 0006511
+YDR054C = 0000082
+YDR054C = 0000086
+YDL165W = 0000122
+YDL165W = 0000749
+YDL165W = 0000074
+YDL165W = 0006357
+YDL165W = 0000289
+YDR168W = 0007103
+YDR168W = 0007103
+YDR168W = 0007165
+YDR168W = 0000074
+YCR093W = 0000122
+YCR093W = 0000749
+YCR093W = 0000074
+YCR093W = 0006357
+YCR093W = 0000289
+YFL009W = 0006511
+YFL009W = 0000082
+YFL009W = 0000086
+YFL009W = 0000086
+YDR364C = 0006260
+YDR364C = 0000084
+YDR364C = 0006371
+YDR364C = 0000071
+YLR229C = 0006887
+YLR229C = 0007118
+YLR229C = 0007119
+YLR229C = 0007124
+YLR229C = 0007125
+YLR229C = 0007266
+YLR229C = 0000750
+YLR229C = 0000750
+YLR229C = 0000283
+YGL155W = 0006874
+YGL155W = 0007264
+YGL155W = 0000283
+YLR103C = 0006270
+YLR103C = 0006267
+YLR274W = 0006268
+YLR274W = 0006270
+YLR274W = 0006267
+YBR202W = 0006268
+YBR202W = 0006270
+YBR202W = 0006267
+YDL126C = 0006511
+YDL126C = 0006511
+YDL126C = 0006906
+YDL126C = 0007049
+YDL126C = 0007049
+YDL126C = 0015031
+YMR001C = 0006261
+YMR001C = 0006468
+YMR001C = 0007096
+YCR094W = 0045449
+YCR094W = 0045449
+YCR094W = 0000080
+YCR094W = 0000080
+YCR094W = 0000080
+YDL132W = 0006511
+YDL132W = 0000082
+YDL132W = 0000086
+YPR019W = 0006268
+YPR019W = 0006270
+YPR019W = 0006267
+YGL190C = 0006412
+YGL190C = 0007015
+YGL190C = 0007094
+YGL190C = 0007117
+YGL190C = 0007124
+YJL194W = 0006267
+YPL160W = 0006429
+tQ(CUG)M = 0006414
+YDL017W = 0006270
+YDL017W = 0006275
+YDL017W = 0006468
+YLR418C = 0006368
+YJR057W = 0006233
+YJR057W = 0006235
+YJR057W = 0006261
+YJR057W = 0006261
+YJR057W = 0006261
+YJR057W = 0006276
+YJR057W = 0006280
+YJR057W = 0006280
+YJR057W = 0006281
+YDL164C = 0006266
+YDL164C = 0006266
+YDL164C = 0006273
+YDL164C = 0006273
+YDL164C = 0006284
+YDL164C = 0006289
+YDL164C = 0006310
+YLR459W = 0000004
+YLR245C = 0006216
+YLR245C = 0006217
+YGL003C = 0000022
+YGL003C = 0006511
+YGL003C = 0007091
+YGL003C = 0000070
+YGL003C = 0008054
+YGL003C = 0008361
+YBR029C = 0006655
+YBR029C = 0006658
+YMR213W = 0006371
+YMR213W = 0006371
+YGL130W = 0006370
+YER061C = 0006634
+YER061C = 0006634
+YMR168C = 0007094
+YPL228W = 0006370
+YDR301W = 0006379
+YDR301W = 0006379
+YDR301W = 0006378
+YDR301W = 0006378
+YLR115W = 0006379
+YLR115W = 0006379
+YLR115W = 0006378
+YLR115W = 0006378
+YGL029W = 0007046
+YGL029W = 0006364
+YCL064C = 0009071
+YLR098C = 0006355
+YLR098C = 0009063
+YLR098C = 0009063
+YGL206C = 0016192
+YER164W = 0006368
+YER164W = 0006338
+YBR274W = 0000077
+YBR274W = 0006468
+YBR274W = 0006468
+YPL008W = 0007059
+YDR254W = 0007059
+YDR254W = 0007059
+YER026C = 0006659
+YGR157W = 0006656
+YNL192W = 0007114
+YBR038W = 0016288
+YBR038W = 0006970
+YBR023C = 0016288
+YBR023C = 0006038
+YBR023C = 0006970
+YLR330W = 0006039
+YLR330W = 0007152
+YLR330W = 0000747
+YLR330W = 0006893
+YJL099W = 0006893
+YJL099W = 0006893
+YJL099W = 0006038
+YHR142W = 0006038
+YHR142W = 0006888
+YHR052W = 0030163
+YHR052W = 0030163
+YHR052W = 0030163
+YMR198W = 0000132
+YMR198W = 0000070
+YMR198W = 0000071
+YMR198W = 0007126
+YMR198W = 0007126
+YOR349W = 0007023
+YOR349W = 0007025
+YPL241C = 0007017
+YMR138W = 0007017
+YOR028C = 0006357
+YOR028C = 0009651
+YOR028C = 0042493
+YEL061C = 0000070
+YEL061C = 0000071
+YEL061C = 0000092
+YDR022C = 0000079
+YJL158C = 0007047
+YNR001C = 0006099
+YNR001C = 0006101
+YNR001C = 0006537
+YCR005C = 0006097
+YCR005C = 0006101
+YCR005C = 0006537
+YPR001W = 0006099
+YPR001W = 0006101
+YPR001W = 0019541
+YIL035C = 0000128
+YIL035C = 0006468
+YIL035C = 0006873
+YIL035C = 0000082
+YIL035C = 0000086
+YIL035C = 0000283
+YIL035C = 0006356
+YIL035C = 0006359
+YIL035C = 0006974
+YOR061W = 0000128
+YOR061W = 0006468
+YOR061W = 0006873
+YOR061W = 0000082
+YOR061W = 0000086
+YOR061W = 0000283
+YOR061W = 0006356
+YOR061W = 0006359
+YOR061W = 0006974
+YGL019W = 0000128
+YGL019W = 0006468
+YGL019W = 0006873
+YGL019W = 0000082
+YGL019W = 0000086
+YGL019W = 0000283
+YGL019W = 0006356
+YGL019W = 0006359
+YGL019W = 0006974
+YOR039W = 0000128
+YOR039W = 0006468
+YOR039W = 0006873
+YOR039W = 0000082
+YOR039W = 0000086
+YOR039W = 0000283
+YOR039W = 0006356
+YOR039W = 0006359
+YOR039W = 0006974
+YLR133W = 0006656
+YBR135W = 0000074
+YNL298W = 0016288
+YNL298W = 0006468
+YNL298W = 0007118
+YNL298W = 0007266
+YNL298W = 0000283
+YGR108W = 0000079
+YGR108W = 0008315
+YGR108W = 0008315
+YGR108W = 0000086
+YGR108W = 0000086
+YGR108W = 0000086
+YGR108W = 0000071
+YGR108W = 0000071
+YPR119W = 0000079
+YPR119W = 0000086
+YPR119W = 0000086
+YDL155W = 0000079
+YDL155W = 0000082
+YDL155W = 0000082
+YDL155W = 0000086
+YDL155W = 0000086
+YLR210W = 0000079
+YLR210W = 0000082
+YLR210W = 0000082
+YLR210W = 0000086
+YLR210W = 0000086
+YPR120C = 0000079
+YPR120C = 0000082
+YPR120C = 0000082
+YPR120C = 0006279
+YPR120C = 0006279
+YPR120C = 0000086
+YPR120C = 0000086
+YGR109C = 0000079
+YGR109C = 0000082
+YGR109C = 0006279
+YGR109C = 0006279
+YGR167W = 0016192
+YLR117C = 0008380
+YLR117C = 0008380
+YLR117C = 0007049
+YGL215W = 0007049
+YMR199W = 0000079
+YMR199W = 0000082
+YPL256C = 0000079
+YPL256C = 0000082
+YPL256C = 0000321
+YAL040C = 0000079
+YAL040C = 0000082
+YOR250C = 0006379
+YOR250C = 0006378
+YMR012W = 0006413
+YMR012W = 0007005
+YBR109C = 0007010
+YBR109C = 0007067
+YBR109C = 0007114
+YFR014C = 0006468
+YFR014C = 0007165
+YOL016C = 0006468
+YOL016C = 0007165
+YML057W = 0006873
+YML057W = 0000754
+YLR433C = 0006873
+YLR433C = 0007047
+YLR433C = 0007047
+YLR433C = 0000754
+YKL190W = 0006873
+YKL190W = 0007047
+YKL190W = 0007047
+YKL190W = 0000754
+YAL058W = 0030433
+YNL225C = 0007020
+YBR155W = 0006457
+Q0105 = 0009060
+Q0105 = 0006122
+YLL050C = 0030042
+YLL050C = 0030042
+YLL050C = 0006897
+YLL050C = 0007015
+YLL050C = 0007015
+YLL050C = 0007047
+YGL223C = 0006891
+YGL223C = 0006891
+YGL223C = 0000301
+YGR120C = 0006888
+YGR120C = 0006891
+YGR120C = 0006891
+YGR120C = 0000301
+YGR120C = 0000301
+YER157W = 0006888
+YER157W = 0006891
+YER157W = 0006891
+YER157W = 0000301
+YER157W = 0000301
+YPR105C = 0006891
+YPR105C = 0006891
+YPR105C = 0000301
+YNL051W = 0006891
+YNL051W = 0006891
+YNL041C = 0006891
+YNL041C = 0006891
+YGL005C = 0006891
+YGL005C = 0006891
+YML071C = 0006891
+YML071C = 0006891
+YDL145C = 0006890
+YDL145C = 0006888
+YBR003W = 0006743
+YNR041C = 0006743
+YOL096C = 0006743
+YDR204W = 0006743
+YML110C = 0006743
+YML110C = 0009060
+YGR255C = 0006743
+YBL045C = 0009060
+YNL336W = 0000004
+YNR075W = 0006897
+YGL263W = 0000004
+YBR302C = 0000004
+YML132W = 0000004
+YFL062W = 0000004
+YJR161C = 0000004
+YGR295C = 0000004
+YDL248W = 0000004
+YHL048W = 0006986
+YKL219W = 0000004
+YOR316C = 0006824
+YOR316C = 0006829
+YOR316C = 0006882
+Q0045 = 0009060
+YPL172C = 0006784
+YPL132W = 0009060
+YLR038C = 0008535
+YGL191W = 0009060
+YML129C = 0008535
+YML129C = 0009060
+YER141W = 0008535
+YER141W = 0006784
+YER141W = 0006784
+YJL003W = 0000004
+YLL009C = 0015680
+YLL009C = 0015680
+YLL009C = 0008535
+YGR062C = 0008535
+YLL018C-A = 0008535
+YLL018C-A = 0008535
+YLL018C-A = 0030001
+YLL018C-A = 0030001
+Q0250 = 0009060
+YDR231C = 0009060
+YDR231C = 0016485
+YDR231C = 0008535
+Q0275 = 0009060
+YGL187C = 0009060
+YNL052W = 0009060
+YIL111W = 0009061
+YHR051W = 0009060
+YMR256C = 0009060
+YLR395C = 0009060
+YDL067C = 0009060
+YKL179C = 0000004
+YOR303W = 0006526
+YJR109C = 0006526
+YGR247W = 0006259
+YGR247W = 0007126
+YDR155C = 0019538
+YDR155C = 0019538
+YHR057C = 0000004
+YML078W = 0006457
+YCR069W = 0000004
+YDR304C = 0000004
+YLR216C = 0006457
+YLR216C = 0006457
+YNR028W = 0000004
+YJL172W = 0006807
+YJL172W = 0006508
+YJL172W = 0006508
+YNL130C = 0006656
+YOR100C = 0006631
+YDL142C = 0008610
+YDL142C = 0007006
+YDL142C = 0008610
+YGR189C = 0000004
+YGR218W = 0000055
+YGR218W = 0006611
+YGR218W = 0006406
+YLR429W = 0007015
+YLR429W = 0007015
+YLR429W = 0007017
+YHR146W = 0000004
+YLR213C = 0000004
+YOR031W = 0009412
+YNL027W = 0006355
+YNL027W = 0019722
+YNL027W = 0019722
+YNL027W = 0019722
+YGL238W = 0006611
+YGL238W = 0006611
+YNR010W = 0006366
+YNR010W = 0000070
+YKL049C = 0000070
+YLR087C = 0006113
+YBR036C = 0006874
+YMR025W = 0000338
+YNL232W = 0006365
+YNL232W = 0006402
+YCR086W = 0045132
+YIL132C = 0045132
+YMR048W = 0045132
+YPL200W = 0045132
+YJR084W = 0000004
+YDR179C = 0000338
+YLR380W = 0015914
+YLR380W = 0007047
+YPR030W = 0007047
+YPR030W = 0006357
+YPR030W = 0006357
+YIL036W = 0006367
+YIL036W = 0006259
+YLR394W = 0000067
+YDR256C = 0006800
+YMR094W = 0000069
+YMR078C = 0007062
+YPL018W = 0007059
+YPL018W = 0008608
+YPL018W = 0008608
+YPL018W = 0008608
+YPL018W = 0007059
+YLR381W = 0007059
+YPR135W = 0006261
+YPR135W = 0006261
+YPR135W = 0006281
+YPR135W = 0006281
+YPR135W = 0006281
+YPR135W = 0006281
+YHR191C = 0007062
+YDR151C = 0006370
+YKL139W = 0006357
+YKL139W = 0006468
+YJL006C = 0006357
+YJL006C = 0006468
+YML112W = 0006357
+YML112W = 0006468
+YMR180C = 0006396
+YHR109W = 0006464
+YBR291C = 0006843
+YBR291C = 0006843
+YPR124W = 0006412
+YPR124W = 0015677
+YHR175W = 0015680
+YHR175W = 0015677
+YLR411W = 0015677
+YCR054C = 0000004
+YOL145C = 0007059
+YOL145C = 0006366
+YOL145C = 0006368
+YLR286C = 0007109
+YDR371W = 0000004
+YGR088W = 0006950
+YMR264W = 0045184
+YMR264W = 0030433
+YKL090W = 0000004
+YGL110C = 0000004
+YML101C = 0000004
+YOR042W = 0000004
+YHR053C = 0046688
+YHR055C = 0046688
+YGL166W = 0046688
+YGL166W = 0006367
+YGL166W = 0006367
+YEL027W = 0006623
+YEL027W = 0006878
+YEL027W = 0006879
+YEL027W = 0006897
+YEL027W = 0007033
+YEL027W = 0007035
+YEL027W = 0007035
+YPL177C = 0006878
+YPL177C = 0006367
+YMR240C = 0000245
+YNL286W = 0006371
+YNL286W = 0006371
+YCR068W = 0006914
+YCR068W = 0006914
+YCR068W = 0006914
+YCR068W = 0006914
+YCR068W = 0006624
+YCR068W = 0006624
+YCR068W = 0030397
+YCR068W = 0030397
+YOL082W = 0006623
+YDL113C = 0006914
+YDL113C = 0006623
+YDL113C = 0006623
+YPR049C = 0030242
+YPR049C = 0006623
+YDR163W = 0000004
+YDL209C = 0006371
+YDL209C = 0006371
+YDR482C = 0000004
+YGR278W = 0000004
+YGL128C = 0000004
+YLR323C = 0000004
+YNL245C = 0000004
+YPL064C = 0000004
+YCL007C = 0007047
+YGL027C = 0007047
+YGL027C = 0007047
+YCR017C = 0007165
+YCR017C = 0007047
+YKL096W = 0007047
+YKL096W = 0007047
+YKL096W-A = 0007047
+YKL096W-A = 0007047
+YML054C = 0006118
+YNL111C = 0016126
+YNL111C = 0016126
+YJR048W = 0006118
+YOR037W = 0045041
+YOR037W = 0007006
+YAL039C = 0018063
+YEL039C = 0006118
+YBR112C = 0016481
+YBR112C = 0016481
+YBR112C = 0016481
+YDL117W = 0016288
+YDR430C = 0000004
+YJL005W = 0007126
+YJL005W = 0007188
+YJL005W = 0007265
+YJL005W = 0000074
+YAL012W = 0019346
+YAL012W = 0000096
+YAL012W = 0006534
+YGR155W = 0019344
+YOR065W = 0006119
+YOR065W = 0006122
+YOR065W = 0006122
+YKL087C = 0018063
+YKL087C = 0018063
+YDR016C = 0000071
+YKR083C = 0000071
+YBR233W-A = 0000004
+YDR320C-A = 0000004
+YML070W = 0019563
+YFL053W = 0019563
+YIR027C = 0000256
+YIR027C = 0000256
+YIR027C = 0000256
+YIR029W = 0000256
+YIR032C = 0000256
+YIR028W = 0015720
+YJR152W = 0015719
+YIR031C = 0000256
+YKR034W = 0006350
+YIR023W = 0006357
+YIR023W = 0006357
+YIR023W = 0019740
+YNL314W = 0006367
+YNL314W = 0000256
+YGR113W = 0000071
+YJR150C = 0015918
+YLR037C = 0000004
+YBR301W = 0000004
+YJR151C = 0000004
+YPL170W = 0000004
+YHR028C = 0016485
+YML113W = 0000122
+YGR092W = 0000280
+YPR111W = 0006468
+YPR111W = 0007049
+YPR111W = 0007049
+YDR052C = 0006270
+YDR052C = 0006275
+YDR052C = 0006468
+YPL119C = 0006397
+YPL119C = 0006397
+YDL031W = 0000027
+YDL031W = 0006365
+YNL112W = 0000004
+YGL078C = 0000027
+YGL078C = 0006365
+YOR046C = 0006406
+YOR046C = 0006406
+YNR038W = 0000027
+YNR038W = 0006365
+YKR024C = 0000027
+YKR024C = 0006365
+YHR169W = 0006365
+YHR169W = 0006365
+YLR276C = 0000027
+YLR276C = 0006365
+YKL149C = 0006401
+YKL149C = 0006401
+YCL016C = 0007062
+YHR144C = 0006220
+YHR144C = 0006220
+YIR030C = 0006807
+YOR180C = 0006635
+YOL149W = 0006402
+YOL149W = 0000290
+YNL118C = 0006402
+YNL118C = 0000290
+YEL015W = 0000004
+YMR135C = 0000004
+YLR361C = 0000004
+YLR270W = 0000290
+YLR270W = 0000290
+YLR270W = 0000290
+YOR173W = 0000004
+YKL046C = 0009272
+YPL194W = 0000075
+YER143W = 0016192
+YER143W = 0016192
+YER143W = 0006511
+YOR163W = 0015959
+YOL052C-A = 0006950
+YMR173W = 0006281
+YMR173W = 0006281
+YOR204W = 0006413
+YHR019C = 0006421
+YHR019C = 0006421
+YHR019C = 0006421
+YKL054C = 0006974
+YKL054C = 0006511
+YKL054C = 0006511
+YFL001W = 0006396
+YBR163W = 0000004
+YAL013W = 0006644
+YAL013W = 0006357
+YBR201W = 0030433
+YIL049W = 0007124
+YOR030W = 0007125
+YMR238W = 0007124
+YMR238W = 0009272
+YOR236W = 0006760
+YOR245C = 0019915
+YOR245C = 0019432
+YOR245C = 0019432
+YDL160C = 0000290
+YDL160C = 0000184
+YKL078W = 0007046
+YKL078W = 0007046
+YMR316W = 0007124
+YMR316W = 0007125
+YOR080W = 0007125
+YDL024C = 0007124
+YDL024C = 0007125
+YHR011W = 0007124
+YHR011W = 0007125
+YHR011W = 0009060
+YHR011W = 0009060
+YPR082C = 0006371
+YLR348C = 0006835
+YLR348C = 0006835
+YKR035W-A = 0006623
+YKL002W = 0045053
+YKL002W = 0045324
+YGR227W = 0006488
+YGR227W = 0006487
+YPL049C = 0007125
+YDR480W = 0007125
+YPL266W = 0000154
+YPL266W = 0006365
+YOR145C = 0000004
+YDR263C = 0006281
+YDR263C = 0006281
+YLR129W = 0030490
+YLR129W = 0030490
+YPL265W = 0006865
+YOL021C = 0006365
+YOL021C = 0006402
+YDR403W = 0007152
+YDR403W = 0007152
+YDR402C = 0007152
+YDR402C = 0007152
+YIR004W = 0016558
+YDL174C = 0005975
+YDL174C = 0009060
+YDL178W = 0000004
+YEL071W = 0006089
+YMR126C = 0000004
+YER179W = 0007126
+YER179W = 0007131
+YER179W = 0000709
+YMR211W = 0000002
+YMR211W = 0006276
+MAK1-3 = 0006260
+MAK1-3 = 0007049
+MAK1-3 = 0007049
+YHR164C = 0006261
+YHR164C = 0006261
+YHR164C = 0006273
+YHR164C = 0006273
+YHR164C = 0006273
+YHR164C = 0006273
+YHR164C = 0006281
+YHR164C = 0006281
+YER166W = 0006886
+YDR093W = 0006886
+YMR162C = 0006886
+YOR005C = 0006303
+YLL001W = 0007005
+YKL213C = 0006511
+YDR069C = 0006275
+YDR069C = 0016579
+YGL240W = 0000022
+YGL240W = 0006511
+YGL240W = 0007091
+YGL240W = 0000070
+YGL240W = 0008054
+YHR044C = 0006006
+YHR043C = 0006006
+YHR043C = 0006950
+YNL001W = 0006412
+YDR273W = 0007126
+YDR273W = 0007152
+YDR141C = 0000902
+YDR141C = 0000902
+YDR068W = 0000004
+YDR440W = 0016571
+YDR440W = 0006348
+YDR440W = 0040020
+YIL010W = 0030503
+YIL010W = 0030503
+YER088C = 0030447
+YER088C = 0006357
+YER088C = 0006348
+YER088C = 0000183
+YER088C = 0009826
+YJL090C = 0006272
+YJL090C = 0006273
+YJL090C = 0006289
+YJL090C = 0006298
+YPR175W = 0006272
+YPR175W = 0006273
+YPR175W = 0006289
+YPR175W = 0006298
+YBR278W = 0006272
+YBR278W = 0006273
+YBR278W = 0006289
+YBR278W = 0006298
+YDR121W = 0006272
+YDR121W = 0006272
+YDR121W = 0006272
+YDR121W = 0006273
+YDR121W = 0006273
+YDR121W = 0006273
+YKL191W = 0017183
+YLR172C = 0017183
+YDR294C = 0019722
+YDR294C = 0006665
+YDR294C = 0006665
+YDR294C = 0009267
+YPR183W = 0006487
+YPR183W = 0006493
+YPR183W = 0006506
+YDR284C = 0006644
+YLL018C = 0006412
+YKR071C = 0000004
+YIL003W = 0008151
+YLL008W = 0000027
+YLL008W = 0006365
+YAL026C = 0006892
+YAL026C = 0006892
+YAL026C = 0006886
+YER124C = 0007047
+YHR143W = 0007047
+YHR143W = 0007109
+YHR143W = 0007109
+YOR264W = 0000004
+YNR067C = 0007109
+YNR067C = 0007109
+YMR276W = 0007103
+YNL258C = 0006890
+YIR010W = 0007059
+YPR017C = 0045045
+YPR017C = 0045045
+YGL043W = 0006368
+YGL043W = 0007131
+YDL219W = 0019478
+YBR180W = 0007152
+YBR180W = 0015837
+YDL101C = 0006468
+YDL101C = 0000077
+YDL101C = 0000075
+YGL061C = 0000071
+YBR208C = 0019627
+YHL016C = 0015840
+YHL016C = 0015840
+YML080W = 0006400
+YBR252W = 0009213
+YKR054C = 0000132
+YKR054C = 0000132
+YKR054C = 0000022
+YKR054C = 0000065
+YKR054C = 0000070
+YDR424C = 0030029
+YDR424C = 0007017
+YHR068W = 0008612
+YPR023C = 0016573
+YPR023C = 0006357
+YEL018W = 0000004
+YJR082C = 0000004
+YKL204W = 0016478
+YKL204W = 0016478
+YKL172W = 0006364
+YDR206W = 0007004
+YDR206W = 0007004
+YLR284C = 0006635
+YLR284C = 0006635
+YAL059W = 0007047
+YEL030W = 0006626
+YDR446W = 0007047
+YHR021W-A = 0007047
+YBL043W = 0007047
+YHR132C = 0007047
+YBL001C = 0007047
+YMR128W = 0007046
+YMR128W = 0007046
+YMR128W = 0030490
+YJR137C = 0000103
+YJR137C = 0007047
+YDR125C = 0007047
+YLR390W = 0007047
+YBR065C = 0007047
+YBL101C = 0007047
+YLR228C = 0016126
+YPL021W = 0007047
+YPL021W = 0007124
+YJL201W = 0007047
+YJR106W = 0007047
+YHL030W = 0007047
+YOR092W = 0007047
+YLR436C = 0007047
+YBR176W = 0015940
+YER176W = 0006449
+YBR078W = 0007047
+YHL043W = 0007047
+YIL146C = 0007047
+YLR299W = 0007047
+YNR030W = 0006488
+YNR030W = 0006486
+YNR030W = 0006486
+YKR076W = 0007047
+YMR062C = 0006592
+YMR062C = 0007047
+YMR176W = 0007047
+YLR443W = 0007047
+YBR076W = 0007047
+YKR004C = 0007047
+YFR027W = 0007062
+YFR027W = 0006260
+YFR027W = 0006281
+YGL222C = 0000290
+YGL222C = 0000290
+YER035W = 0000290
+YBL047C = 0006897
+YBR033W = 0000004
+YAL003W = 0006414
+YMR212C = 0000902
+YOR133W = 0006414
+YDR385W = 0006414
+YPL037C = 0006444
+YHR193C = 0006444
+YNL327W = 0016288
+YBR177C = 0006629
+YDR147W = 0006646
+YNL230C = 0006368
+YPL046C = 0006368
+YKL160W = 0016049
+YOR144C = 0000335
+YOR144C = 0045910
+YKL048C = 0016288
+YKL048C = 0006468
+YKL048C = 0006970
+YKL048C = 0007117
+YKL048C = 0007120
+YKL048C = 0007124
+YJL196C = 0019368
+YGR200C = 0006357
+YPL086C = 0006357
+YPL101W = 0006357
+YMR312W = 0006357
+YLR186W = 0030490
+YLR186W = 0042274
+YDR512C = 0000004
+YDR516C = 0000004
+YOL071W = 0000004
+YGL200C = 0016050
+YGL200C = 0016050
+YGL200C = 0006888
+YLR080W = 0006888
+YLR080W = 0006888
+YFL048C = 0006888
+YLR083C = 0006810
+tM(CAU)D = 0006414
+tM(CAU)O2 = 0006414
+tM(CAU)J2 = 0006414
+tM(CAU)M = 0006414
+tM(CAU)J1 = 0006414
+YDR040C = 0006814
+YDR039C = 0006814
+YDR038C = 0006814
+YOL158C = 0015685
+YNL084C = 0016288
+YNL084C = 0000147
+YNL084C = 0006897
+YNL084C = 0007015
+YNL084C = 0007121
+YGR254W = 0006094
+YGR254W = 0006096
+YHR174W = 0006094
+YHR174W = 0006096
+YBR247C = 0008151
+YGR145W = 0000004
+RF3 = 0006371
+YDL161W = 0000147
+YDL161W = 0006897
+YDL161W = 0007015
+YLR206W = 0000147
+YLR206W = 0006897
+YLR206W = 0007015
+YJR125C = 0000147
+YJR125C = 0006897
+YJR125C = 0007015
+YJR125C = 0006895
+YLL038C = 0000147
+YLL038C = 0006897
+YLL038C = 0007015
+YDR153C = 0006895
+YFL024C = 0016573
+YFL024C = 0006357
+YIL005W = 0006621
+YHR123W = 0006646
+YMR049C = 0006364
+YDR414C = 0006621
+YBL040C = 0006621
+YLR246W = 0006612
+YGR175C = 0006696
+YPL028W = 0006696
+YHR007C = 0006696
+YMR208W = 0006696
+YML126C = 0006696
+YMR202W = 0006696
+YJL167W = 0006696
+YNL280C = 0006696
+YGR060W = 0006696
+YGL001C = 0006696
+YLR100W = 0006696
+YER044C = 0006696
+YER044C = 0006696
+YLR056W = 0006696
+YGL012W = 0006696
+YMR015C = 0006696
+YML008C = 0006696
+YHR072W = 0006696
+YMR220W = 0006696
+YMR220W = 0008299
+YHR190W = 0006696
+YPL096C-A = 0000004
+YML130C = 0006457
+YML130C = 0006467
+YAR002C-A = 0006888
+YAL007C = 0006888
+YDL018C = 0045045
+YOR016C = 0045045
+YOR016C = 0045045
+YHR110W = 0045045
+YGL002W = 0045045
+YGL002W = 0045045
+YOR393W = 0000004
+YPL281C = 0000004
+YCR075C = 0015811
+YGR029W = 0007005
+YGR029W = 0006879
+YGL054C = 0006888
+YGL054C = 0006888
+YGL054C = 0007120
+YGL054C = 0007151
+YGL054C = 0006888
+YPR037C = 0006467
+YML012W = 0006888
+YGR284C = 0006888
+YML067C = 0006888
+YAL042W = 0006888
+YOR244W = 0000074
+YOR244W = 0016573
+YOR244W = 0006357
+YNL125C = 0006810
+YMR219W = 0006348
+YDR363W = 0006347
+YOL017W = 0006342
+YGR098C = 0000022
+YGR098C = 0000022
+YGR098C = 0016359
+YGR098C = 0016359
+YJR017C = 0006397
+YLR233C = 0007004
+YLR318W = 0007004
+YIL009C-A = 0007004
+YBR026C = 0009060
+YBR026C = 0006633
+YDR518W = 0006466
+YDR518W = 0006457
+YLR300W = 0007047
+YLR300W = 0006073
+YLR300W = 0006073
+YDR261C = 0000004
+YOR033C = 0006298
+YJL085W = 0016288
+YJL085W = 0006893
+YJL085W = 0006904
+YJL085W = 0006906
+YJL085W = 0007121
+YJL085W = 0000283
+YBR102C = 0006371
+YBR102C = 0006371
+YBR102C = 0016288
+YBR102C = 0006893
+YBR102C = 0006893
+YBR102C = 0006904
+YBR102C = 0006904
+YBR102C = 0006906
+YBR102C = 0006906
+YBR102C = 0007121
+YBR102C = 0000283
+YOR317W = 0006499
+YOR317W = 0006499
+YOR317W = 0006629
+YOR317W = 0006629
+YER015W = 0006499
+YER015W = 0006499
+YER015W = 0006629
+YER015W = 0006629
+YIL009W = 0006499
+YIL009W = 0006499
+YIL009W = 0006629
+YIL009W = 0006629
+YMR246W = 0006499
+YMR246W = 0006499
+YMR246W = 0006629
+YMR246W = 0006629
+YFR019W = 0007033
+YFR019W = 0007033
+YFR019W = 0006644
+YFR019W = 0006644
+YDL045C = 0006747
+YDL045C = 0006747
+YDR021W = 0006365
+YDR021W = 0006371
+YNL023C = 0000004
+YDL166C = 0006979
+YJL157C = 0000750
+YJL157C = 0000750
+YJL157C = 0000750
+YJL157C = 0007050
+YMR052W = 0007050
+YMR052W = 0000749
+YKL182W = 0006633
+YPL231W = 0006633
+YBR041W = 0000038
+YBR041W = 0006869
+YBR041W = 0006869
+YBR222C = 0006869
+YER183C = 0009396
+YKL060C = 0006094
+YKL060C = 0006096
+YLR377C = 0006094
+YJL155C = 0006094
+YMR277W = 0006470
+YMR277W = 0006350
+YPR062W = 0019858
+YER056C = 0006863
+YER056C = 0015856
+YER060W = 0000004
+YER060W-A = 0000004
+YOR388C = 0042183
+YOR388C = 0042183
+YOR388C = 0006735
+YPL275W = 0042183
+YPL275W = 0042183
+YCR034W = 0006899
+YCR034W = 0030497
+YCR034W = 0030148
+YCR028C = 0015887
+YCR028C = 0015887
+YMR058W = 0006827
+YMR319C = 0000040
+YMR319C = 0015680
+YFL041W = 0006826
+YPR104C = 0006364
+YPR104C = 0006383
+YBR040W = 0000753
+YBR040W = 0000755
+YCR089W = 0000753
+YCR089W = 0000755
+YNL325C = 0000753
+YHR038W = 0006412
+YHR038W = 0006412
+YDR130C = 0000004
+YJR093C = 0006378
+YJR093C = 0006378
+YJR093C = 0006379
+YJR093C = 0006379
+YER032W = 0006378
+YER032W = 0006378
+YIL065C = 0000266
+YIL065C = 0000266
+YIL065C = 0000266
+YIL065C = 0000266
+YDR534C = 0015891
+YOR382W = 0015891
+YOR383C = 0015891
+YIL131C = 0006347
+YIL131C = 0006347
+YIL131C = 0007124
+YIL131C = 0007124
+YIL131C = 0000074
+YIL131C = 0000074
+YNL068C = 0000116
+YNL068C = 0000116
+YNL068C = 0007124
+YNL068C = 0000074
+YNL068C = 0000074
+YNL068C = 0000074
+YNL068C = 0000074
+YNL068C = 0007124
+YLR342W = 0006075
+YLR342W = 0007047
+YMR306W = 0000004
+YAR050W = 0000128
+YKR102W = 0000004
+YHR211W = 0000128
+YER109C = 0007124
+YER109C = 0007125
+YAL063C = 0000004
+YBR008C = 0009636
+YBR008C = 0009636
+YIL134W = 0006839
+YIL134W = 0006839
+YIL098C = 0006461
+YIL098C = 0006461
+YDR236C = 0009398
+YDR236C = 0009398
+YHR176W = 0006457
+YMR020W = 0015940
+YBL013W = 0006413
+YBL013W = 0006431
+YDR110W = 0006310
+YDR110W = 0007580
+YNL256W = 0009396
+YGR267C = 0009396
+YMR113W = 0009396
+YKR009C = 0006635
+YNL135C = 0000004
+YDR519W = 0000004
+YML074C = 0000004
+YLR449W = 0000004
+YLL043W = 0006810
+YLL043W = 0000747
+YLR214W = 0006826
+YLR214W = 0015677
+YKL220C = 0006826
+YKL220C = 0015677
+YOR381W = 0015892
+YOR381W = 0006879
+YOR381W = 0006879
+YOR381W = 0006879
+YOR381W = 0006879
+YNR060W = 0015892
+YOR384W = 0000004
+YLL051C = 0000004
+YOL152W = 0000004
+YCL026C-A = 0045922
+YDR373W = 0000004
+YLR060W = 0006432
+YFL022C = 0006432
+YHR049W = 0000004
+YMR222C = 0000004
+YOR280C = 0000004
+YJL221C = 0000004
+YBR207W = 0006897
+YER145C = 0006827
+YBL042C = 0015862
+YBL042C = 0015862
+YPL262W = 0006099
+YPL262W = 0006106
+YAL036C = 0000004
+YAL035W = 0006413
+YAL008W = 0000004
+YAL034C = 0000004
+YAL031C = 0000004
+YAL022C = 0015858
+YAL019W = 0007001
+YNR002C = 0006810
+YNR002C = 0019740
+YHR128W = 0008655
+YBR021W = 0015857
+YCL027W = 0000747
+YMR232W = 0045026
+YBL016W = 0006468
+YBL016W = 0007050
+YBL016W = 0000750
+YDR024W = 0000004
+YIL097W = 0000004
+YOR183W = 0000004
+YHR059W = 0000004
+YCL058C = 0000004
+YNL133C = 0000004
+YLR068W = 0000004
+YGR196C = 0000004
+YGL254W = 0000316
+YBR179C = 0007005
+YLR088W = 0016255
+YOR178C = 0000122
+YOR178C = 0005977
+YOR178C = 0007094
+YOR178C = 0007126
+YOR178C = 0009408
+YOR178C = 0009408
+YMR250W = 0006979
+YMR250W = 0006538
+YMR250W = 0006538
+YBR020W = 0006012
+YBR019C = 0006012
+YOL051W = 0006366
+YLR081W = 0006012
+YLR081W = 0006859
+YDR009W = 0006012
+YDR009W = 0006355
+YPL248C = 0006012
+YPL248C = 0006355
+YBR018C = 0006012
+YML051W = 0006012
+YML051W = 0006355
+YER027C = 0006468
+YER027C = 0007165
+YKR039W = 0006865
+YHR089C = 0000154
+YHR089C = 0006365
+YMR307W = 0007047
+YMR215W = 0000004
+YOL132W = 0000004
+YOL030W = 0000004
+YFL021W = 0006367
+YFL021W = 0006808
+YMR136W = 0006350
+YLR013W = 0006350
+YIR013C = 0006350
+YCL011C = 0000004
+YOR260W = 0006413
+YNL062C = 0006413
+YNL062C = 0030488
+YER025W = 0006413
+YJL125C = 0030488
+YGR083C = 0006413
+YDR211W = 0006413
+YLR291C = 0006413
+YGL195W = 0006448
+YGL195W = 0006448
+YDR283C = 0006468
+YDR283C = 0008652
+YDR283C = 0006446
+YFR009W = 0006448
+YFR009W = 0006448
+YKR026C = 0006413
+YEL009C = 0008652
+YEL009C = 0006357
+YGR252W = 0016568
+YGR252W = 0016573
+YPL075W = 0045821
+YNL199C = 0045821
+YDL226C = 0006888
+YDL226C = 0006888
+YDL226C = 0006890
+YDL226C = 0006890
+YDL226C = 0006890
+YDL226C = 0030037
+YDL226C = 0030037
+YDL226C = 0030037
+YDR019C = 0006730
+YDR019C = 0006730
+YDR019C = 0006544
+YMR189W = 0006730
+YMR189W = 0006730
+YAL044C = 0006730
+YAL044C = 0006730
+YOR120W = 0009651
+YEL042W = 0006486
+YPR184W = 0005980
+YOR375C = 0019268
+YDL215C = 0006807
+YAL062W = 0006537
+YAL062W = 0006537
+YER136W = 0016192
+YOR355W = 0009060
+YOR355W = 0009060
+YJR031C = 0006888
+YJR031C = 0006891
+YEL022W = 0006888
+YEL022W = 0006891
+YJR040W = 0030003
+YKL104C = 0006038
+YMR255W = 0006406
+YMR255W = 0006406
+YCL036W = 0000004
+YDR358W = 0006896
+YDR358W = 0006896
+YHR108W = 0006896
+YHR108W = 0006896
+YHR061C = 0007120
+YHR061C = 0007266
+YHR061C = 0000283
+YDR309C = 0007120
+YDR309C = 0007266
+YDR309C = 0000283
+YIR024C = 0000004
+YNL153C = 0007021
+YNL153C = 0007021
+YEL003W = 0007021
+YEL003W = 0007021
+YML094W = 0007021
+YML094W = 0007021
+YIL130W = 0000004
+YDR507C = 0000135
+YDR507C = 0000135
+YDR507C = 0006468
+YDR507C = 0007117
+YDR507C = 0007117
+YDR507C = 0007120
+YDR507C = 0000094
+YDR507C = 0000094
+YBR045C = 0007152
+YER054C = 0000004
+YDR096W = 0007242
+YNL255C = 0007242
+YLR094C = 0007242
+YML006C = 0007242
+YCR098C = 0015914
+YEL011W = 0005977
+YER133W = 0000122
+YER133W = 0005977
+YER133W = 0007094
+YER133W = 0007126
+YER133W = 0009408
+YER133W = 0009408
+YER133W = 0030447
+YMR311C = 0005978
+YDL207W = 0016973
+YER107C = 0006406
+YER107C = 0006407
+YER107C = 0006408
+YER107C = 0006409
+YER107C = 0006606
+YER107C = 0006607
+YER107C = 0006608
+YER107C = 0006609
+YER107C = 0006610
+YER107C = 0006611
+YER107C = 0006998
+YER107C = 0006999
+YKR058W = 0005978
+YJL137C = 0005978
+YCL040W = 0005975
+YPR035W = 0006807
+YPR035W = 0006807
+YER040W = 0006807
+YOR168W = 0006418
+YOR168W = 0006418
+YML004C = 0006749
+YDR272W = 0005975
+YER122C = 0006888
+YER122C = 0006888
+YER122C = 0006890
+YER122C = 0006890
+YER122C = 0006890
+YOR040W = 0005975
+YPL091W = 0006979
+YDL171C = 0006537
+YEL046C = 0006567
+YEL046C = 0006545
+YFL017C = 0006048
+YFL017C = 0006048
+YHR183W = 0006006
+YHR183W = 0006006
+YGR256W = 0006006
+YGR256W = 0006006
+YDR508C = 0006865
+YOR320C = 0000004
+YGR002C = 0000004
+YHL031C = 0006891
+YHL031C = 0006906
+YMR292W = 0006888
+YMR292W = 0006895
+YHR005C = 0000750
+YER020W = 0007124
+YER020W = 0007151
+YER020W = 0007165
+YER020W = 0008151
+YOR371C = 0007165
+YAL056W = 0007165
+YDL022W = 0006973
+YOL059W = 0006071
+YGL121C = 0007165
+YPR160W = 0005980
+YGR216C = 0006506
+YGR216C = 0006506
+YGL142C = 0006506
+YDR302W = 0006506
+YMR281W = 0006506
+YLL031C = 0006506
+YNL038W = 0006506
+YNL038W = 0006506
+YHR188C = 0016255
+YDR434W = 0016255
+YDR434W = 0016255
+YPL076W = 0006506
+YPL076W = 0006506
+YPL076W = 0006506
+YDR331W = 0016255
+YKL152C = 0006094
+YKL152C = 0006096
+YDL021W = 0006094
+YDL021W = 0006096
+YOL056W = 0006094
+YOL056W = 0006096
+YDL035C = 0007186
+YDL035C = 0007186
+YDL035C = 0007124
+YKR067W = 0008654
+YKR067W = 0008654
+YKR067W = 0008654
+YKL026C = 0006979
+YBR244W = 0006979
+YLL035W = 0008151
+YLL035W = 0008151
+YOR357C = 0008104
+YPL223C = 0006950
+YOL151W = 0006950
+YHR104W = 0006950
+YHR104W = 0019566
+YDR517W = 0007094
+YJR090C = 0006511
+YJR090C = 0000082
+YBR121C = 0006353
+YBR121C = 0006426
+YBR121C = 0006426
+YPR081C = 0006426
+YCL035C = 0006979
+YCL035C = 0030503
+YCL035C = 0030503
+YCL035C = 0030503
+YDR098C = 0006979
+YDR098C = 0006979
+YER174C = 0006979
+YER174C = 0006979
+YPL059W = 0006970
+YPL059W = 0006979
+YPL059W = 0006979
+YGR032W = 0006075
+YGR032W = 0007047
+YML048W = 0045045
+YML048W = 0045045
+YML048W = 0045045
+YDR108W = 0006888
+YDR108W = 0007126
+YJL101C = 0006750
+YOL049W = 0006750
+YLR293C = 0006913
+YLR293C = 0006997
+YLR293C = 0006997
+YLR293C = 0006364
+YOR185C = 0006997
+YOR185C = 0006997
+YFR015C = 0005977
+YFR015C = 0005977
+YFR015C = 0005977
+YLR258W = 0005977
+YLR258W = 0005977
+YLR258W = 0005977
+YML121W = 0006817
+YGR163W = 0000004
+YGL181W = 0000902
+YGL181W = 0006855
+YGL181W = 0006855
+YGL181W = 0007151
+YGL181W = 0000074
+YGL181W = 0007574
+YGL181W = 0007624
+YIR038C = 0006749
+YLL060C = 0006749
+YEL017W = 0000004
+YMR217W = 0046037
+YLR289W = 0000004
+YDR454C = 0046037
+YGL084C = 0015793
+YGL084C = 0015793
+YGL084C = 0019563
+YGL084C = 0019563
+YPL189W = 0000004
+YHL032C = 0006071
+YIL155C = 0005975
+YOR070C = 0016192
+YPL249C = 0016192
+YJL044C = 0006886
+YDL234C = 0016192
+YFL027C = 0016192
+YJL110C = 0006807
+YJL110C = 0000122
+YJL110C = 0000122
+YPR008W = 0006367
+YFL031W = 0006357
+YFL031W = 0006644
+YFL031W = 0006990
+YPR005C = 0009651
+YPR005C = 0009651
+YPR005C = 0006367
+YJL165C = 0030003
+YJL165C = 0030003
+YOL089C = 0009651
+YOL089C = 0006367
+YJR069C = 0006281
+YLR256W = 0045944
+YLR256W = 0009060
+YGL237C = 0006350
+YGL237C = 0006109
+YBL021C = 0006350
+YBL021C = 0006109
+YKL109W = 0006350
+YKL109W = 0006109
+YOR358W = 0006350
+YOR358W = 0006109
+YMR290C = 0000004
+YPL001W = 0016573
+YPL001W = 0006348
+YEL056W = 0006333
+YEL056W = 0006348
+YKR084C = 0006412
+YKR084C = 0006412
+YDL223C = 0000753
+YJL033W = 0006365
+YNL281W = 0006457
+YNL281W = 0006457
+YNL281W = 0006457
+YNL281W = 0006950
+YNL281W = 0006950
+YNL281W = 0006950
+YCR065W = 0007051
+YCR065W = 0006367
+YLR192C = 0006412
+YLR192C = 0006412
+YKL017C = 0006273
+YNL021W = 0006325
+YNL021W = 0006325
+YNL021W = 0006355
+YNL021W = 0006355
+YNL021W = 0006476
+YNL021W = 0006476
+YNL021W = 0007574
+YBR138C = 0000004
+YNL014W = 0006414
+YBL032W = 0008298
+YBL032W = 0008298
+YBL032W = 0007004
+YBL032W = 0007004
+YDR232W = 0006783
+YDR047W = 0006783
+YDR044W = 0006783
+YER014W = 0006783
+YOR176W = 0006783
+YGL040C = 0006783
+YDL205C = 0006783
+YOR278W = 0006783
+YOR237W = 0006694
+YOR237W = 0006694
+YDL013W = 0006310
+YDL013W = 0006310
+YDL013W = 0007151
+YDL013W = 0006974
+YMR207C = 0000004
+YPL254W = 0016568
+YPL254W = 0016573
+YPL254W = 0006366
+YGL251C = 0007126
+YGR187C = 0000004
+YBR009C = 0006333
+YNL030W = 0006333
+YPL127C = 0006355
+YBR010W = 0006333
+YNL031C = 0006333
+YLL022C = 0000004
+YGR191W = 0006828
+YGR191W = 0015817
+YBL008W = 0006357
+YOR038C = 0006357
+YJR140C = 0000083
+YER055C = 0000105
+YFR025C = 0000105
+YOR202W = 0000105
+YCL030C = 0000105
+YIL116W = 0000105
+YIL020C = 0000105
+YBR248C = 0000105
+YJR055W = 0009060
+YDR420W = 0007047
+YDR420W = 0006075
+YDR420W = 0000282
+YMR161W = 0000004
+YDR528W = 0007047
+YER057C = 0000004
+YML075C = 0006696
+YLR450W = 0006696
+YOL095C = 0000002
+YCL066W = 0007532
+YCL066W = 0006357
+YCL067C = 0007532
+YCL067C = 0006357
+YCL067C = 0007535
+YDR174W = 0006276
+YCR097W = 0007532
+YCR096C = 0007532
+YOR032C = 0007124
+YJR147W = 0007124
+YBR034C = 0018195
+YBR034C = 0018195
+YBR034C = 0006406
+YBR034C = 0006406
+YLR205C = 0006879
+YLR205C = 0006879
+YGL077C = 0015871
+YGL077C = 0015871
+YDL125C = 0009117
+YDR305C = 0009164
+YOR258W = 0000004
+YDL227C = 0007533
+YDL227C = 0007534
+YJR075W = 0000032
+YJR075W = 0006080
+YJR075W = 0006491
+YMR032W = 0016288
+YLR113W = 0006972
+YNR055C = 0006810
+YNR055C = 0006810
+YDR158W = 0006566
+YDR158W = 0006555
+YER052C = 0006555
+YER052C = 0006566
+YJR139C = 0006555
+YJR139C = 0006566
+YIL072W = 0007126
+YIL072W = 0007130
+YGL033W = 0007129
+YER062C = 0005975
+YER062C = 0006970
+YER062C = 0006114
+YMR251W-A = 0006950
+YPR068C = 0006325
+YPR068C = 0006325
+YPR068C = 0006355
+YPR068C = 0006355
+YPR068C = 0006476
+YPR068C = 0006476
+YGL194C = 0006325
+YGL194C = 0006325
+YGL194C = 0006355
+YGL194C = 0006355
+YGL194C = 0016575
+YGL194C = 0016575
+YGL194C = 0045835
+YPL116W = 0016575
+YIL112W = 0045835
+YIL112W = 0016575
+YIL112W = 0016575
+YMR172W = 0006972
+YMR172W = 0006972
+YMR172W = 0006357
+YPR193C = 0016573
+YEL066W = 0016573
+YBR215W = 0000083
+YDR138W = 0006310
+YDR138W = 0006351
+YDR138W = 0006368
+YDR138W = 0006406
+YJL092W = 0006281
+YJL092W = 0006303
+YDR399W = 0006164
+YNL004W = 0006606
+YOL013C = 0030433
+YOL013C = 0030433
+YOL013C = 0030433
+YOL013C = 0030433
+YLR207W = 0030433
+YOR267C = 0006873
+YOR267C = 0006873
+YOL123W = 0006379
+YOL123W = 0006378
+YPL204W = 0008151
+YPL204W = 0007126
+YPL204W = 0007067
+YPL204W = 0007059
+YPL204W = 0000280
+YPL204W = 0006281
+YOL133W = 0006511
+YOL133W = 0000082
+YOL133W = 0000086
+YMR027W = 0000004
+YLR097C = 0000004
+YMR186W = 0006457
+YMR186W = 0006950
+YOR311C = 0000004
+YHL002W = 0006623
+YHL002W = 0006623
+YGL073W = 0006950
+YGL073W = 0006950
+YGL073W = 0006950
+YGL073W = 0009408
+YGL073W = 0009408
+YGL073W = 0009408
+YMR288W = 0000245
+YMR288W = 0000245
+YOR319W = 0006371
+YOR319W = 0006371
+YKL138C-A = 0000004
+YKL101W = 0000135
+YKL101W = 0000135
+YKL101W = 0006468
+YKL101W = 0000074
+YKL101W = 0000086
+YKL101W = 0000086
+YKL101W = 0000078
+YBR133C = 0000086
+YBR133C = 0000086
+YBR133C = 0000074
+YBR272C = 0006298
+YOR020C = 0006457
+YLL026W = 0006457
+YLL026W = 0006950
+YFL014W = 0006972
+YFL014W = 0006979
+YFL014W = 0007155
+YFL014W = 0009408
+YJL159W = 0007047
+YBR072W = 0006457
+YBR072W = 0006950
+YCR021C = 0006950
+YCR021C = 0006457
+YDR171W = 0006950
+YDR171W = 0007010
+YDR171W = 0007010
+YLR259C = 0006457
+YLR259C = 0006628
+YDR258C = 0006457
+YDR258C = 0006628
+YDR258C = 0006950
+YDR258C = 0000002
+YPL240C = 0006457
+YPL240C = 0006950
+YOL068C = 0016440
+YOL068C = 0016440
+YPL015C = 0006348
+YPL015C = 0006348
+YOR025W = 0006348
+YDR191W = 0006348
+tR(CCU)J = 0006414
+YDR225W = 0006333
+YBL003C = 0006333
+YDR224C = 0006333
+YDR224C = 0006333
+YDR224C = 0006333
+YBL002W = 0006333
+YCR020W-B = 0000067
+YCR020W-B = 0000074
+YCR020W-B = 0000074
+YPR033C = 0006427
+YPR033C = 0006427
+YOL012C = 0006347
+YOL012C = 0006347
+YOL012C = 0006357
+YOL012C = 0006357
+YGR268C = 0000004
+YOR284W = 0000004
+YPR171W = 0000004
+YNR032C-A = 0000753
+YNR032C-A = 0006464
+YML058W-A = 0006974
+YML058W-A = 0006974
+YML058W-A = 0000075
+YML058W-A = 0000075
+YML058W-A = 0007050
+YML058W-A = 0007050
+YJR036C = 0000209
+YJR036C = 0006513
+YGL141W = 0000209
+YGL141W = 0006513
+YGL168W = 0000004
+YPL244C = 0015785
+YER039C = 0000004
+YFR053C = 0006000
+YGL253W = 0006000
+YHR094C = 0008645
+YFL011W = 0008645
+YOL156W = 0008645
+YIL170W = 0000004
+YEL069C = 0008645
+YNL318C = 0008645
+YDL245C = 0008645
+YJR158W = 0008645
+YNR072W = 0008645
+YMR011W = 0008645
+YDR345C = 0008645
+YHR092C = 0008645
+YHR096C = 0008645
+YDR343C = 0008645
+YDR342C = 0008645
+YJL214W = 0008645
+YJL219W = 0008645
+YKL189W = 0007109
+YKL189W = 0008360
+YEL034W = 0006413
+YIR037W = 0006979
+YJR006W = 0006272
+YJR006W = 0006273
+YJR006W = 0006280
+YJR006W = 0006284
+YJR006W = 0006289
+YJR006W = 0006301
+YJR006W = 0006298
+YOR126C = 0006083
+YNL164C = 0007094
+YNL164C = 0007094
+YER065C = 0006097
+YPR006C = 0019541
+YPR006C = 0019541
+YPR006C = 0006567
+YBR157C = 0000004
+YJL077C = 0000004
+YLR099C = 0000004
+YMR195W = 0000004
+YPL250C = 0000004
+YNL037C = 0006099
+YNL037C = 0006102
+YNL037C = 0006537
+YOR136W = 0006099
+YOR136W = 0006102
+YOR136W = 0006537
+YPL117C = 0006696
+YDL066W = 0006102
+YDL066W = 0006537
+YLR174W = 0006102
+YLR174W = 0006537
+YNL009W = 0006102
+YNL009W = 0006635
+YNL009W = 0006740
+YJL146W = 0007126
+YFL013C = 0000004
+YNL215W = 0000004
+YLR052W = 0000004
+YOR189W = 0000004
+YER092W = 0000004
+YEL044W = 0000004
+YLR223C = 0006348
+YLR223C = 0006364
+YLR223C = 0006364
+YOL023W = 0006413
+YOL023W = 0006413
+YHR187W = 0006357
+YLR384C = 0006357
+YJL057C = 0000004
+YJR118C = 0000004
+YBL076C = 0006412
+YER086W = 0009082
+YMR108W = 0009082
+YMR108W = 0009082
+YJR016C = 0009082
+YLR355C = 0009082
+YLR355C = 0000002
+YCL009C = 0009082
+YCL009C = 0009082
+YAR073W = 0006183
+YHR216W = 0006183
+YLR432W = 0006183
+YML056C = 0000004
+YJR094C = 0007126
+YJL106W = 0040020
+YGL192W = 0007126
+YGL192W = 0016556
+YGL192W = 0016556
+YCR046C = 0006412
+YCR071C = 0006412
+YLR309C = 0016192
+YJR138W = 0000004
+YJL082W = 0000004
+YBR107C = 0007059
+YMR150C = 0006627
+YMR035W = 0006627
+YIL154C = 0005975
+YIL154C = 0006281
+YHR148W = 0000154
+YHR148W = 0006365
+YHR148W = 0030490
+YHR148W = 0007046
+YNL075W = 0000154
+YNL075W = 0006365
+YNL075W = 0030490
+tM(CAU)O1 = 0006413
+tM(CAU)P = 0006413
+tM(CAU)J3 = 0006413
+tM(CAU)E = 0006413
+YDL181W = 0015986
+YHR046C = 0006020
+YJL153C = 0006020
+YDR123C = 0045944
+YDR123C = 0045944
+YDR123C = 0008654
+YOL108C = 0008654
+YOL108C = 0045944
+YOL108C = 0045944
+YOL108C = 0045944
+YGL150C = 0006338
+YGL150C = 0006366
+YGL150C = 0006366
+YGL150C = 0006281
+YGL150C = 0006281
+YIL002C = 0016311
+YIL002C = 0006661
+YIL002C = 0007047
+YNL106C = 0016311
+YNL106C = 0007047
+YOR109W = 0016311
+YOR109W = 0007047
+YOL065C = 0006887
+YLR095C = 0000004
+YFR013W = 0006338
+YMR044W = 0000004
+YHR085W = 0000004
+YHR197W = 0000004
+YNL182C = 0000004
+YDR315C = 0006020
+YDR315C = 0006020
+YDR315C = 0006020
+YPL209C = 0007059
+YBR011C = 0006796
+YDR072C = 0006676
+YPL242C = 0016288
+YPL242C = 0006970
+YPL242C = 0007015
+YBR140C = 0007151
+YBR140C = 0007265
+YOL081W = 0007265
+YHR079C = 0006020
+YHR079C = 0006987
+YHR079C = 0006988
+YIL026C = 0007064
+YIL026C = 0007149
+YIL026C = 0007153
+YIL026C = 0000755
+YKR019C = 0000183
+YLL027W = 0006826
+YLL027W = 0006826
+YPR067W = 0006826
+YPR067W = 0006826
+YER019W = 0009651
+YER019W = 0030149
+YER180C = 0030435
+YMR081C = 0009060
+YPL040C = 0006412
+YPL040C = 0006412
+YPL040C = 0006428
+YPL040C = 0006428
+YPR106W = 0000004
+YNL265C = 0000004
+YBR086C = 0006970
+YIR005W = 0000245
+YPL135W = 0006879
+YPL135W = 0006879
+YPL135W = 0016226
+YPL135W = 0016226
+YOR226C = 0006879
+YOR226C = 0006879
+YOR226C = 0016226
+YOR226C = 0016226
+YBR245C = 0006338
+YBR245C = 0006338
+YBR245C = 0006338
+YOR304W = 0006338
+YOR304W = 0006338
+YOR304W = 0006338
+YJR050W = 0006371
+YJR050W = 0006371
+YGL133W = 0000004
+YDR497C = 0015798
+YOL103W = 0015798
+YML068W = 0006449
+YDL115C = 0000004
+YPR133C = 0006368
+YKL032C = 0006281
+YGL018C = 0009060
+YGL018C = 0016226
+YJL073W = 0000742
+YJL073W = 0000742
+YJL073W = 0006457
+YKL217W = 0015727
+YLR331C = 0000004
+YDR475C = 0000004
+YPR169W = 0000004
+YMR294W = 0000092
+YMR294W = 0000092
+YJR091C = 0000288
+YKR038C = 0000004
+YBR017C = 0006606
+YBR017C = 0006606
+YBR017C = 0006606
+YBR017C = 0006606
+YBR017C = 0006609
+YBR017C = 0006609
+YBR017C = 0006609
+YBR017C = 0006609
+YGL241W = 0006606
+YGL241W = 0006606
+YPL125W = 0006606
+YGL016W = 0006606
+YGL016W = 0042493
+YER110C = 0006606
+YLR347C = 0006606
+YNL188W = 0000742
+YNL188W = 0000742
+YNL188W = 0007103
+YJL034W = 0000742
+YJL034W = 0000742
+YJL034W = 0006616
+YPR141C = 0000742
+YPR141C = 0007126
+YPR141C = 0007126
+YPR141C = 0007067
+YCL055W = 0000742
+YCL055W = 0007126
+YCL055W = 0007067
+YCL055W = 0045944
+YMR065W = 0000742
+YMR065W = 0000742
+YPL269W = 0000065
+YCL024W = 0000135
+YCL024W = 0000135
+YCL024W = 0006468
+YCL024W = 0007117
+YCL024W = 0007117
+YCL024W = 0007120
+YCL024W = 0000094
+YCL024W = 0000094
+YDR017C = 0007033
+YDR017C = 0006950
+YHR158C = 0000902
+YHR158C = 0045026
+YHR158C = 0000755
+YHR158C = 0000755
+YHR158C = 0000755
+YHR158C = 0008360
+YGR238C = 0000747
+YPL263C = 0000004
+YGL173C = 0006365
+YGL173C = 0006402
+YPL145C = 0006694
+YPL145C = 0006694
+YPL145C = 0016192
+YGL203C = 0016485
+YNL238W = 0007323
+YIL125W = 0006099
+YIL125W = 0006103
+YDR148C = 0006099
+YDR148C = 0006103
+YJL094C = 0015672
+YJL094C = 0015672
+YER187W-A = 0000004
+YHR102W = 0000902
+YHR102W = 0000902
+YDR122W = 0000004
+YLR096W = 0000004
+YDL108W = 0006367
+YDL108W = 0006367
+YDL108W = 0006468
+YDL108W = 0007070
+YAR018C = 0000004
+YOR233W = 0000004
+YCR091W = 0000004
+YBL063W = 0007020
+YBL063W = 0000092
+YPL155C = 0000065
+YPL155C = 0007026
+YPL155C = 0000092
+YGL216W = 0000132
+YGL216W = 0000132
+YGL216W = 0000065
+YGL216W = 0007019
+YGL216W = 0000071
+YGL216W = 0000071
+YKL168C = 0000004
+YDL049C = 0006078
+YDL049C = 0006078
+YLL019C = 0006468
+YHR186C = 0000004
+YNL322C = 0007047
+YGR166W = 0006888
+YDR483W = 0000032
+YDR483W = 0006491
+YDR483W = 0006493
+YIL027C = 0000004
+YER038C = 0000004
+YNL132W = 0000004
+YOR336W = 0006078
+YPR159W = 0007047
+YPR159W = 0006078
+YPR159W = 0006078
+YJL174W = 0006077
+YJL174W = 0007047
+YNL308C = 0007046
+YCL059C = 0007046
+YDR037W = 0006430
+YHR082C = 0006468
+YGR040W = 0006468
+YGR040W = 0007050
+YGR040W = 0007124
+YGR040W = 0000750
+YBL071W-A = 0000080
+YKL110C = 0008151
+YKL110C = 0015976
+YOR099W = 0000032
+YOR099W = 0006491
+YOR099W = 0006493
+YKR061W = 0000032
+YKR061W = 0006487
+YBR205W = 0006487
+YBR205W = 0006493
+YBR205W = 0007047
+YBR199W = 0006487
+YNL029C = 0006487
+YNL029C = 0007047
+YPL053C = 0006487
+YPL053C = 0007047
+YIL085C = 0006487
+YIL085C = 0007047
+YKL008C = 0007568
+YHL003C = 0007568
+YOL025W = 0007568
+YNL239W = 0046677
+YKL103C = 0007039
+YKL103C = 0007039
+YKR063C = 0007117
+YKR063C = 0000283
+YOR181W = 0016288
+YOR181W = 0006897
+YOR181W = 0006970
+YOR181W = 0007015
+YOR181W = 0007121
+YOR181W = 0008154
+YJL062W = 0006506
+YNL071W = 0006090
+YMR296C = 0030148
+YDR062W = 0030148
+YJL134W = 0030148
+YJL134W = 0019722
+YOR171C = 0006665
+YOR171C = 0019722
+YLR260W = 0009408
+YLR260W = 0006665
+YLR260W = 0019722
+YDR499W = 0045184
+YDR499W = 0045184
+YDR499W = 0000077
+YDR499W = 0000077
+YDR499W = 0007004
+YER127W = 0000154
+YER127W = 0006365
+YPL213W = 0006371
+YPL054W = 0000004
+YNL323W = 0007166
+YOR123C = 0006366
+YOR123C = 0006368
+YGL009C = 0009098
+YCL018W = 0009098
+YLR451W = 0006357
+YLR451W = 0009098
+YNL104C = 0009098
+YHR002W = 0015880
+YPL055C = 0006259
+YPL055C = 0007126
+YDL051W = 0008033
+YKL073W = 0006986
+YKL073W = 0006986
+YKL073W = 0015031
+YKL073W = 0015031
+YKL073W = 0006986
+YKL073W = 0006986
+YGL090W = 0006303
+YHR156C = 0000004
+YLR239C = 0009249
+YLR239C = 0009249
+YOR196C = 0006631
+YFR001W = 0042273
+YFR001W = 0042273
+YKL205W = 0006388
+YKL205W = 0006409
+YKL183W = 0000004
+YLR011W = 0000004
+YFL018C = 0006086
+YFL018C = 0006546
+YFL018C = 0006550
+YFL018C = 0006552
+YFL018C = 0006564
+YFL018C = 0006574
+YPL060W = 0045016
+YPL060W = 0045016
+YPL060W = 0045016
+YDR503C = 0006644
+YCL051W = 0009408
+YCL051W = 0007047
+YDL240W = 0007264
+YDL240W = 0007264
+YDL240W = 0009272
+YNR008W = 0019915
+YNR008W = 0019915
+YNR008W = 0019432
+YNR008W = 0019432
+YHR081W = 0000004
+YDR439W = 0000183
+YGR136W = 0000004
+YFR024C-A = 0000004
+YCL034W = 0007015
+YCL034W = 0006897
+YJL100W = 0007015
+YOR142W = 0006099
+YOR142W = 0006104
+YGR244C = 0006099
+YGR244C = 0006104
+YGL099W = 0000747
+YGL099W = 0007151
+YJL124C = 0000288
+YJL124C = 0000288
+YJL124C = 0000290
+YJL124C = 0000290
+YJL124C = 0000290
+YBL026W = 0006371
+YLR438C-A = 0006371
+YER112W = 0006371
+YER146W = 0006371
+YDR378C = 0006371
+YNL147W = 0006402
+YNL147W = 0006402
+YNL147W = 0006371
+YJR022W = 0006371
+YPL004C = 0000004
+LSR1 = 0006371
+YKL176C = 0015031
+YKL176C = 0006886
+YKL176C = 0016192
+YKL176C = 0006893
+YGR057C = 0015031
+YGR057C = 0006886
+YGR057C = 0016192
+YGR057C = 0006893
+YNL006W = 0006810
+YAL024C = 0007096
+YPR073C = 0006470
+YKL143W = 0006950
+YDL087C = 0006376
+YDL087C = 0006376
+YDR027C = 0006896
+YNL268W = 0015802
+YIR034C = 0019878
+YIL094C = 0009085
+YDR034C = 0019878
+YBR115C = 0019878
+YDL182W = 0019878
+YDL131W = 0019878
+YDR234W = 0019878
+YGL154C = 0019878
+YMR038C = 0015680
+YMR038C = 0015680
+YNR050C = 0019878
+YMR021C = 0045944
+YMR021C = 0006876
+YGL086W = 0007094
+YGL086W = 0007094
+YJL030W = 0007094
+YJL030W = 0007094
+YJL013C = 0007094
+YJL013C = 0007094
+YKL029C = 0006090
+YKL029C = 0006520
+YDR005C = 0016480
+YDR005C = 0016480
+YER142C = 0006307
+YER142C = 0006307
+YER142C = 0006307
+YLR427W = 0000004
+YPL100W = 0006624
+YEL053C = 0006474
+YEL053C = 0019048
+YKL021C = 0019048
+YKL021C = 0042273
+YAL025C = 0019048
+YAL025C = 0042273
+YDR060W = 0000027
+YPR051W = 0006474
+YPR051W = 0019048
+YCR020C-A = 0006474
+YCR020C-A = 0019048
+YCR019W = 0019048
+YBR142W = 0000027
+YBR142W = 0006364
+YGR289C = 0000017
+YGR292W = 0000025
+YGR288W = 0006355
+YGR288W = 0005975
+YBR298C = 0006810
+YBR298C = 0000017
+YBR299W = 0000025
+YBR297W = 0000023
+YBR297W = 0005975
+YBR297W = 0006355
+YER106W = 0045132
+YER106W = 0045132
+YOL060C = 0007005
+YIL070C = 0009060
+YLR244C = 0006508
+YBL091C = 0006508
+YLR163C = 0006627
+YHR024C = 0006627
+YNR017W = 0006628
+HMRA1 = 0007532
+HMRA2 = 0007532
+YCR040W = 0007532
+YCR040W = 0006357
+YCR039C = 0007532
+YCR039C = 0006357
+YCR039C = 0007535
+YBR185C = 0009060
+YBR185C = 0007007
+YJL199C = 0000004
+YOR298C-A = 0045944
+YDL056W = 0006260
+YDL056W = 0006260
+YDL056W = 0000074
+YDL056W = 0000074
+YKL093W = 0009060
+YOR197W = 0006915
+YDL003W = 0007064
+YDL003W = 0007064
+YDL003W = 0007076
+YKL165C = 0006506
+YDL054C = 0006810
+YKL221W = 0006810
+YOL119C = 0006810
+YOR306C = 0006810
+YNL307C = 0006468
+YNL307C = 0000070
+YNL307C = 0000070
+YNL307C = 0007126
+YNL307C = 0007151
+YMR043W = 0006357
+YIL150C = 0006270
+YIL150C = 0006270
+YIL150C = 0006271
+YPR046W = 0007059
+YBL023C = 0006268
+YBL023C = 0006270
+YBL023C = 0006267
+YDR318W = 0007059
+YJR135C = 0007059
+YEL032W = 0006268
+YEL032W = 0006270
+YEL032W = 0006267
+YGL201C = 0006268
+YGL201C = 0006270
+YGL201C = 0006270
+YKL150W = 0006696
+YKL150W = 0006118
+YKL150W = 0006979
+YOR221C = 0006631
+YOR221C = 0006631
+YOR221C = 0009060
+YBR227C = 0000004
+YNL173C = 0000750
+YKL085W = 0006099
+YKL085W = 0006108
+YOL126C = 0006094
+YOL126C = 0006097
+YOL126C = 0006108
+YDL078C = 0006097
+YDL078C = 0006108
+YDL078C = 0006635
+YDL078C = 0006735
+YFL016C = 0006457
+YFL016C = 0006508
+YNL328C = 0006457
+YNL328C = 0006457
+YLR188W = 0006857
+YLR188W = 0006857
+YPL270W = 0009060
+YML104C = 0007005
+YML104C = 0007097
+YML104C = 0000001
+YAL010C = 0000001
+YAL010C = 0000002
+YAL010C = 0007005
+YOL009C = 0000001
+YOL009C = 0007005
+YOL076W = 0000001
+YOL076W = 0000001
+YOL076W = 0007010
+YLR368W = 0007005
+YHR194W = 0007005
+YOR147W = 0007005
+YGL219C = 0007005
+YKL053C-A = 0007005
+YPR083W = 0007005
+YOL027C = 0007005
+YGL020C = 0007005
+YLR106C = 0006461
+YGR100W = 0000004
+YGL197W = 0030435
+YGL197W = 0030435
+YJL112W = 0000266
+YJL112W = 0000266
+YJL112W = 0000266
+YJL112W = 0000266
+YJL112W = 0000266
+YJL112W = 0000266
+YJL112W = 0000266
+YJL112W = 0000002
+YJL112W = 0000002
+YBR136W = 0006310
+YBR136W = 0000076
+YBR136W = 0000077
+YBR136W = 0006139
+YBR136W = 0007131
+YLR288C = 0006348
+YLR288C = 0000077
+YLR288C = 0006259
+YPR070W = 0006366
+YMR112C = 0006366
+YDL005C = 0006366
+YOR174W = 0006366
+YHR058C = 0006366
+YHR058C = 0006366
+YOL135C = 0006366
+YBR193C = 0006366
+YLR069C = 0006414
+YLR069C = 0006414
+YJL102W = 0006414
+YER044C-A = 0030437
+YER044C-A = 0007131
+YER044C-A = 0042138
+YPL121C = 0000004
+YOR351C = 0006468
+YOR351C = 0006468
+YOR351C = 0007126
+YGR121C = 0015696
+YGR121C = 0015696
+YNL142W = 0015696
+YNL142W = 0007124
+YPR138C = 0015696
+YPR138C = 0015696
+YNL210W = 0007126
+YGR264C = 0006418
+YKR069W = 0000103
+YKR069W = 0006555
+YKR069W = 0006780
+YFR030W = 0000103
+YPL023C = 0006555
+YPL023C = 0006555
+YGL125W = 0000097
+YGL125W = 0006555
+YGL125W = 0006412
+YGL125W = 0006555
+YGL125W = 0006555
+YGL125W = 0000097
+YKL001C = 0000103
+YKL001C = 0006555
+YPR167C = 0000103
+YPR167C = 0006555
+YLR303W = 0006555
+YIL128W = 0006289
+YIL128W = 0006366
+YIL128W = 0006366
+YIL128W = 0006555
+YNL277W = 0009086
+YNL277W = 0009092
+YOL064C = 0009086
+YOL064C = 0000103
+YIR017C = 0006357
+YIR017C = 0000097
+YJR010W = 0000103
+YJR010W = 0006555
+YIL046W = 0006511
+YIL046W = 0007049
+YPL038W = 0000096
+YDR253C = 0000096
+YNL103W = 0045944
+YNL103W = 0000096
+YER091C = 0006555
+YOR241W = 0006730
+YBR213W = 0000103
+YBR213W = 0019354
+YLR017W = 0006537
+YPL169C = 0006406
+YPL187W = 0000749
+YGL089C = 0000749
+YDR461W = 0000750
+YDR461W = 0000750
+YNL145W = 0000750
+YNL145W = 0000750
+YML062C = 0006626
+YML062C = 0006368
+YGR249W = 0030447
+YIR033W = 0009409
+YIR033W = 0009409
+YIR033W = 0045944
+YIR033W = 0006631
+YOR232W = 0006628
+YOR211C = 0007005
+YOR211C = 0000002
+YJR144W = 0006281
+YJR144W = 0000002
+YNL218W = 0006260
+YNL218W = 0006260
+YDL200C = 0006307
+YJL042W = 0007026
+YJL042W = 0007047
+YDR296W = 0000002
+YLL062C = 0000096
+YJL104W = 0000004
+YNL291C = 0006816
+YLR332W = 0007047
+YLR332W = 0007047
+YKL089W = 0000071
+YGL035C = 0006357
+YGL035C = 0006006
+YGL209W = 0006006
+YGL209W = 0006357
+YER028C = 0006352
+YMR036C = 0000079
+YMR036C = 0000079
+YMR036C = 0000086
+YOR330C = 0006261
+YHR015W = 0006406
+YJR077C = 0006817
+YBR084W = 0001718
+YBR084W = 0006139
+YDR144C = 0006508
+YOR231W = 0006468
+YOR231W = 0007165
+YPL140C = 0006468
+YPL140C = 0007165
+YNL076W = 0006808
+YNL085W = 0016032
+YGL106W = 0016288
+YGL106W = 0000011
+YGL106W = 0016192
+YGL106W = 0000001
+YGL106W = 0006897
+YGL106W = 0007118
+YGL106W = 0007119
+YGL106W = 0000283
+YPR188C = 0000004
+YNL074C = 0042493
+YMR167W = 0006281
+YMR167W = 0007131
+YLR035C = 0006281
+YPL164C = 0006298
+YPL164C = 0007131
+YKR095W = 0006606
+YIL149C = 0006606
+YNL117W = 0006097
+YIL051C = 0000002
+YIL051C = 0009097
+YLL006W = 0000002
+YLL006W = 0007005
+YLL061W = 0015806
+YPR164W = 0000335
+YPR164W = 0006281
+YPR164W = 0006281
+YGL087C = 0006281
+YGL087C = 0006281
+YGL087C = 0006511
+YEL019C = 0006281
+YLR320W = 0006302
+YBR098W = 0006281
+YBR098W = 0007131
+YMR177W = 0006879
+YMR177W = 0006879
+YPL224C = 0006879
+YPL224C = 0006879
+YGL183C = 0007131
+YIR025W = 0007131
+YOR350C = 0000004
+YHR204W = 0030433
+YHR204W = 0030433
+YER001W = 0006491
+YER001W = 0006493
+YDR245W = 0000032
+YDR245W = 0006080
+YDR245W = 0006491
+YDR245W = 0007015
+YJL183W = 0006486
+YJL183W = 0006486
+YBR015C = 0006486
+YKL201C = 0006950
+YKL201C = 0006493
+YKL201C = 0006487
+YJL186W = 0006486
+YPL050C = 0006487
+YPL050C = 0006487
+YKL064W = 0015693
+YJR131W = 0006487
+YGL257C = 0006493
+YIL014W = 0006493
+YNR059W = 0006493
+YIL106W = 0006468
+YIL106W = 0007096
+YFL034C-B = 0006468
+YFL034C-B = 0007096
+YFL034C-B = 0030012
+YOR274W = 0006400
+YJR074W = 0006606
+YBL049W = 0000004
+YCL039W = 0000004
+YGL124C = 0006623
+YNL297C = 0006623
+YNL297C = 0006810
+YNL297C = 0006810
+YOL063C = 0000004
+YPL082C = 0006357
+YER068W = 0006357
+YER068W = 0000289
+YER068W = 0000747
+YMR070W = 0000747
+YNL249C = 0000004
+YOR177C = 0007152
+YOR288C = 0006466
+YOR288C = 0006457
+YOL088C = 0006466
+YOL088C = 0006457
+YKL059C = 0006378
+YKL059C = 0006378
+YKL059C = 0006378
+YKL059C = 0006378
+YKL059C = 0006379
+YKL059C = 0006379
+YKL059C = 0006379
+YKL059C = 0006379
+YIR002C = 0006281
+YDL247W = 0008643
+YDL247W = 0008643
+YJR160C = 0008643
+YJR160C = 0008643
+YJL066C = 0000004
+YJR002W = 0000154
+YJR002W = 0006365
+YJR002W = 0030490
+YDL028C = 0007094
+YDL028C = 0007103
+YGL075C = 0007103
+YGL075C = 0000090
+YJL019W = 0007103
+YGL178W = 0007574
+YGL178W = 0006605
+YGL178W = 0007047
+YGL178W = 0000321
+YGL178W = 0000288
+YCL061C = 0006348
+YCL061C = 0006348
+YCL061C = 0000076
+YCL061C = 0000076
+YCL061C = 0006347
+YCL061C = 0006347
+YPR112C = 0006365
+YMR224C = 0006281
+YMR224C = 0042138
+YMR224C = 0000706
+YMR224C = 0000727
+YGL143C = 0006412
+YGL143C = 0006412
+YGL143C = 0006415
+YGL143C = 0006415
+YDR033W = 0000004
+YGL064C = 0007046
+YDL079C = 0006468
+YDL079C = 0006468
+YDL079C = 0006508
+YPR079W = 0007034
+YPR079W = 0007034
+YGL136C = 0000154
+YDR347W = 0006412
+YDR347W = 0006412
+YDL045W-A = 0006412
+YDL045W-A = 0006412
+YGR084C = 0006412
+YKL003C = 0006412
+YPR166C = 0006412
+YPR166C = 0006412
+YDR405W = 0006412
+YBL090W = 0006412
+YBL090W = 0006413
+YHL004W = 0006412
+YHL004W = 0006412
+YKL167C = 0006412
+YDR036C = 0006897
+YPL118W = 0006412
+YPL118W = 0006413
+YPL118W = 0006412
+YNL005C = 0006412
+YKL142W = 0006412
+YKL142W = 0006412
+YDR116C = 0006412
+YDR116C = 0007126
+YDR116C = 0009060
+YDR116C = 0009060
+YNL284C = 0006412
+YDL202W = 0006412
+YKR006C = 0006412
+YLR312W-A = 0006412
+YBL038W = 0006412
+YNL252C = 0006412
+YNL185C = 0006412
+YKR085C = 0000002
+YKR085C = 0006412
+YNL177C = 0006412
+YNL177C = 0009060
+YNL177C = 0009060
+YOR150W = 0000027
+YOR150W = 0006412
+YMR193W = 0006412
+YGR076C = 0006412
+YBR282W = 0006412
+YDR462W = 0006412
+YMR024W = 0006412
+YKL138C = 0006412
+YCR003W = 0006412
+YMR286W = 0006412
+YDR322W = 0006412
+YBR122C = 0006412
+YBR268W = 0006412
+YKL170W = 0006412
+YML009C = 0006412
+YLR439W = 0006412
+YPL173W = 0006412
+YMR225C = 0006412
+YJL096W = 0006412
+YNR022C = 0006412
+YPR100W = 0009060
+YPR100W = 0006412
+YHR147C = 0006412
+YDR237W = 0006412
+YJL063C = 0000002
+YJL063C = 0006412
+YGR220C = 0000027
+YGR220C = 0006412
+YPL013C = 0006412
+YMR188C = 0006412
+YMR188C = 0009060
+YMR188C = 0009060
+YNL306W = 0006412
+YDR337W = 0000028
+YDR337W = 0006412
+YDR337W = 0006412
+YGR165W = 0009060
+YGR165W = 0009060
+YGR165W = 0006412
+YBR251W = 0006412
+YBR251W = 0006412
+YMR158W = 0006412
+YBR146W = 0006412
+YBR146W = 0006412
+YIR021W = 0006371
+YIR021W = 0006371
+YHR005C-A = 0006628
+YHR005C-A = 0006628
+YOR334W = 0045016
+YOR334W = 0045016
+YOR334W = 0045016
+YOR334W = 0006371
+YJL133W = 0006810
+YJL133W = 0008380
+YKR052C = 0006810
+YKR052C = 0008380
+YBR091C = 0006628
+YBR091C = 0006628
+YOR370C = 0006886
+YKL009W = 0042273
+YKL009W = 0042273
+YOR188W = 0000283
+YGR014W = 0000283
+YGR014W = 0006970
+YNL293W = 0006887
+YNL293W = 0007015
+YOL112W = 0007015
+YML128C = 0007131
+YDR205W = 0006882
+YLR219W = 0007131
+YOR354C = 0007131
+YHR039C = 0007131
+YPL104W = 0006412
+YPL104W = 0006412
+YOL033W = 0006424
+YOL033W = 0006412
+YOL033W = 0006412
+YPR047W = 0006412
+YKR030W = 0000004
+YNL053W = 0000754
+YHR120W = 0006281
+YOL090W = 0006310
+YOL090W = 0006298
+YOL090W = 0006312
+YOL090W = 0000735
+YCR092C = 0006298
+YCR092C = 0006312
+YCR092C = 0006310
+YCR092C = 0000735
+YFL003C = 0007131
+YDL154W = 0007131
+YDR097C = 0006281
+YDR097C = 0006298
+YBR195C = 0006281
+YBR195C = 0006334
+YBR195C = 0006342
+YBR195C = 0007265
+YNL073W = 0006430
+YNL073W = 0006430
+YIR009W = 0006371
+YIR009W = 0006371
+YLR116W = 0006371
+YGR171C = 0006431
+YGR171C = 0006431
+YOL116W = 0006972
+YOL116W = 0006972
+YMR037C = 0006950
+YMR037C = 0006355
+YKL062W = 0006355
+YKL062W = 0006950
+YDR335W = 0006611
+YNR049C = 0006904
+YNR049C = 0006904
+YNR049C = 0006904
+YNR049C = 0007151
+YNR049C = 0007151
+YNR049C = 0007151
+YGR028W = 0006628
+YHR091C = 0006420
+YHR091C = 0006412
+YHR091C = 0006412
+YMR023C = 0006412
+YMR164C = 0007165
+YDR194C = 0008380
+YPR134W = 0006371
+YPR134W = 0006371
+YDL107W = 0006628
+YDL107W = 0006628
+YDL107W = 0006628
+YDL107W = 0006461
+YDL107W = 0006461
+YDL107W = 0006461
+YDR208W = 0030036
+YDR208W = 0045011
+YLR203C = 0006397
+YLR203C = 0006412
+YKL194C = 0006435
+YKL194C = 0006435
+YMR287C = 0006401
+YMR287C = 0006371
+YDR268W = 0006436
+YPL097W = 0006418
+YKR080W = 0006730
+YKR080W = 0006730
+YKR080W = 0009113
+YKR080W = 0009113
+YMR228W = 0006390
+YDL044C = 0006397
+YMR097C = 0000004
+YDR277C = 0007165
+YDR277C = 0007165
+YDR277C = 0015758
+YGR023W = 0007047
+YGR023W = 0007047
+YGL236C = 0006412
+YOR160W = 0006606
+YOR160W = 0006606
+YOR160W = 0006606
+YOR160W = 0006606
+YOR160W = 0006606
+YOR160W = 0006606
+YOR160W = 0006609
+YOR160W = 0006609
+YOR160W = 0006609
+YOR160W = 0006609
+YOR160W = 0006609
+YOR160W = 0006609
+YKL186C = 0016973
+YKL186C = 0016973
+YKL186C = 0016973
+YGR158C = 0006365
+YGR158C = 0006402
+YJL050W = 0006365
+YAL034W-A = 0007059
+YMR100W = 0007116
+YMR100W = 0007116
+YIR019C = 0007124
+YIR019C = 0007125
+YIR019C = 0016337
+YIR019C = 0030447
+YBR119W = 0006371
+YKL074C = 0000245
+YKL074C = 0006372
+YKL074C = 0006376
+YPL070W = 0000004
+YBR057C = 0006279
+YBR057C = 0006279
+YGR055W = 0000101
+YHL036W = 0006865
+YHL036W = 0006865
+YGR007W = 0006646
+YGR007W = 0006646
+YDR386W = 0007131
+YDR386W = 0006281
+YNR043W = 0006696
+YNR043W = 0008299
+YMR004W = 0006623
+YER042W = 0006979
+YER042W = 0006979
+YER042W = 0006979
+YHR023W = 0016288
+YHR023W = 0006970
+YHR023W = 0007120
+YOR326W = 0000011
+YOR326W = 0016192
+YOR326W = 0016192
+YOR326W = 0000001
+YOR326W = 0006897
+YOR326W = 0006897
+YOR326W = 0007118
+YOR326W = 0007118
+YOR326W = 0007119
+YOR326W = 0007119
+YOR326W = 0000283
+YOR326W = 0000283
+YOR326W = 0000283
+YKL129C = 0006887
+YKL129C = 0006897
+YKL129C = 0006970
+YKL129C = 0007047
+YKL129C = 0007121
+YAL029C = 0008298
+YMR109W = 0006887
+YMR109W = 0006897
+YMR109W = 0006970
+YMR109W = 0007047
+YMR109W = 0007121
+YMR109W = 0009651
+YMR109W = 0009651
+YGL122C = 0016973
+YPL190C = 0006357
+YPL190C = 0006357
+YML117W = 0000004
+YNL124W = 0006810
+YLR382C = 0006429
+YLR382C = 0008380
+YMR080C = 0006402
+YMR080C = 0000184
+YMR080C = 0006449
+YHR086W = 0006376
+YHR086W = 0006371
+YNL137C = 0006412
+YNL137C = 0006412
+YPL126W = 0030490
+YPL126W = 0030490
+YKR048C = 0006334
+YKR048C = 0006334
+YKR048C = 0000087
+YNL240C = 0000004
+YGR232W = 0006508
+YGR232W = 0006508
+YDL040C = 0006473
+YGR147C = 0017196
+YPR131C = 0017196
+YOR253W = 0006473
+YLR457C = 0000004
+YDR162C = 0000004
+YGL091C = 0000004
+YPR155C = 0009060
+YPR155C = 0016071
+YJL116C = 0007005
+YDR397C = 0000122
+YDR397C = 0000122
+YJL205C-A = 0009306
+YPR149W = 0009306
+YPR149W = 0009306
+YNL036W = 0000004
+YPL024W = 0000004
+YBL024W = 0030488
+YHR042W = 0006696
+YPL006W = 0000004
+YML031W = 0006405
+YML031W = 0006405
+YML031W = 0006606
+YML031W = 0006606
+YML031W = 0007020
+YML031W = 0007020
+YML031W = 0007103
+YOR372C = 0000117
+YMR145C = 0019655
+YMR145C = 0019655
+YDL085W = 0019655
+YDL085W = 0019655
+YDL085W = 0019655
+YML120C = 0006120
+YOL104C = 0007129
+YOL104C = 0007129
+YHR124W = 0007126
+YHR124W = 0007126
+YHR124W = 0007126
+YHR124W = 0007126
+YLR265C = 0006281
+YLR265C = 0006302
+YHR004C = 0006997
+YHR004C = 0007151
+YHR004C = 0006997
+YIL048W = 0006886
+YJL076W = 0000183
+YJL076W = 0000183
+YJL076W = 0007000
+YJL076W = 0007096
+YJL076W = 0007096
+YJL076W = 0007096
+YPL226W = 0000004
+YOR156C = 0030261
+YCL017C = 0006879
+YCL017C = 0016226
+YCL017C = 0016226
+YKL040C = 0006879
+YKL040C = 0006879
+YDR176W = 0016568
+YDR176W = 0016573
+YOL042W = 0000004
+YMR285C = 0006364
+YML118W = 0000004
+YBR212W = 0040008
+YLR138W = 0030004
+YDL002C = 0000004
+YDL208W = 0000154
+YDL208W = 0006365
+YPR052C = 0006325
+YPR052C = 0006357
+YPR052C = 0006357
+YPR052C = 0006359
+YPR052C = 0006359
+YPR052C = 0006359
+YBR089C-A = 0006325
+YBR089C-A = 0006357
+YBR089C-A = 0006359
+YBR089C-A = 0006359
+YBR089C-A = 0006359
+YDR456W = 0015672
+YDR456W = 0015672
+YDR456W = 0007035
+YDR456W = 0016197
+YDR456W = 0030004
+YFR002W = 0006406
+YFR002W = 0006407
+YFR002W = 0006408
+YFR002W = 0006409
+YFR002W = 0006606
+YFR002W = 0006607
+YFR002W = 0006608
+YFR002W = 0006609
+YFR002W = 0006610
+YFR002W = 0006611
+YFR002W = 0006999
+YGL221C = 0000004
+YMR309C = 0006413
+YMR309C = 0006413
+YMR309C = 0006413
+YPL174C = 0000092
+YPL174C = 0000092
+YPL211W = 0000027
+YPL211W = 0006364
+YNL078W = 0007088
+YIL164C = 0000004
+YJL126W = 0000004
+YLR351C = 0000004
+YDR383C = 0000004
+YLR315W = 0000004
+YLR328W = 0019674
+YGR010W = 0019674
+YHR077C = 0006402
+YHR077C = 0000184
+YHR170W = 0000027
+YLR363C = 0000184
+YJR132W = 0006606
+YJR132W = 0006606
+NME1 = 0006364
+YLR195C = 0018008
+YJR112W = 0007059
+YGR089W = 0000004
+YLR285W = 0000004
+YOR056C = 0006510
+YOR206W = 0000004
+YLR002C = 0006270
+YLR002C = 0006364
+YPL093W = 0000004
+YNR053C = 0006371
+YDL014W = 0000154
+YDL014W = 0000027
+YDL014W = 0006365
+YDL014W = 0030490
+YHR072W-A = 0000154
+YHR072W-A = 0006365
+YOL041C = 0016072
+YNL175C = 0000004
+YDL148C = 0030490
+YDL148C = 0030490
+YNL110C = 0042273
+YNL110C = 0042273
+YER002W = 0042273
+YER002W = 0042273
+YNL061W = 0006364
+YPL043W = 0006364
+YOR310C = 0000154
+YOR310C = 0006365
+YOR310C = 0030490
+YDL213C = 0000004
+YGR103W = 0042273
+YOL144W = 0000027
+YOL144W = 0006364
+YIL038C = 0006357
+YIL038C = 0000289
+YPR072W = 0006357
+YPR072W = 0000289
+YDR432W = 0006406
+YDR432W = 0006406
+YBR170C = 0006406
+YBR170C = 0006407
+YBR170C = 0006408
+YBR170C = 0006409
+YBR170C = 0006606
+YBR170C = 0006607
+YBR170C = 0006608
+YBR170C = 0006609
+YBR170C = 0006610
+YBR170C = 0006611
+YBR170C = 0006998
+YBR170C = 0006999
+YMR091C = 0006606
+YNL183C = 0006808
+YEL062W = 0015840
+YEL062W = 0015824
+YOR209C = 0000183
+YOR209C = 0006348
+YOR209C = 0019358
+YGL067W = 0006734
+YNL251C = 0006139
+YNL251C = 0006139
+YDR043C = 0006006
+YDR043C = 0006357
+YDR043C = 0007125
+YBR066C = 0007125
+YDL167C = 0000004
+YGL111W = 0042273
+YGL111W = 0042273
+YER126C = 0042273
+YER126C = 0042273
+YLR007W = 0006281
+YLR007W = 0008283
+YPL233W = 0007059
+YJL041W = 0000055
+YJL041W = 0006405
+YJL041W = 0006405
+YJL041W = 0006406
+YJL041W = 0006407
+YJL041W = 0006408
+YJL041W = 0006409
+YJL041W = 0006606
+YJL041W = 0006607
+YJL041W = 0006608
+YJL041W = 0006609
+YJL041W = 0006610
+YJL041W = 0006611
+YJL041W = 0006999
+YJL041W = 0006999
+YJL041W = 0006999
+YGR159C = 0000028
+YGR159C = 0006364
+YNL091W = 0009651
+YJR062C = 0006464
+YJR062C = 0030163
+YBR188C = 0006371
+YBR188C = 0006371
+YER009W = 0006913
+YER009W = 0006606
+YAL015C = 0006281
+YAL015C = 0006285
+YOL043C = 0006285
+YDR001C = 0005993
+YDR001C = 0006950
+YBR001C = 0005993
+YBR001C = 0006950
+YPR031W = 0000004
+YJL208C = 0006310
+YOR373W = 0007020
+YOL069W = 0007020
+YOL069W = 0007059
+YER006W = 0000004
+YDR150W = 0000065
+YDR150W = 0000226
+YOR098C = 0006405
+YOR098C = 0006406
+YOR098C = 0006407
+YOR098C = 0006408
+YOR098C = 0006409
+YOR098C = 0006606
+YOR098C = 0006607
+YOR098C = 0006608
+YOR098C = 0006609
+YOR098C = 0006610
+YOR098C = 0006611
+YOR098C = 0006998
+YOR098C = 0006999
+YKL068W = 0006406
+YKL068W = 0006407
+YKL068W = 0006408
+YKL068W = 0006409
+YKL068W = 0006607
+YKL068W = 0006608
+YKL068W = 0006609
+YKL068W = 0006610
+YKL068W = 0006611
+YKL068W = 0006999
+YMR047C = 0006388
+YMR047C = 0006406
+YMR047C = 0006407
+YMR047C = 0006408
+YMR047C = 0006409
+YMR047C = 0006409
+YMR047C = 0006606
+YMR047C = 0006607
+YMR047C = 0006608
+YMR047C = 0006609
+YMR047C = 0006610
+YMR047C = 0006611
+YMR047C = 0006999
+YKL057C = 0006406
+YKL057C = 0006407
+YKL057C = 0006408
+YKL057C = 0006409
+YKL057C = 0006607
+YKL057C = 0006608
+YKL057C = 0006609
+YKL057C = 0006610
+YKL057C = 0006611
+YKL057C = 0006999
+YKR082W = 0006406
+YKR082W = 0006407
+YKR082W = 0006408
+YKR082W = 0006409
+YKR082W = 0006607
+YKR082W = 0006608
+YKR082W = 0006609
+YKR082W = 0006610
+YKR082W = 0006611
+YKR082W = 0006999
+YGL092W = 0006388
+YGL092W = 0006406
+YGL092W = 0006407
+YGL092W = 0006408
+YGL092W = 0006409
+YGL092W = 0006606
+YGL092W = 0006607
+YGL092W = 0006608
+YGL092W = 0006609
+YGL092W = 0006610
+YGL092W = 0006611
+YGL092W = 0006999
+YER105C = 0006406
+YER105C = 0006406
+YER105C = 0006407
+YER105C = 0006408
+YER105C = 0006409
+YER105C = 0006607
+YER105C = 0006608
+YER105C = 0006609
+YER105C = 0006610
+YER105C = 0006611
+YER105C = 0006999
+YIL115C = 0006406
+YIL115C = 0006999
+YIL115C = 0000054
+YIL115C = 0006407
+YBL079W = 0000059
+YBL079W = 0006406
+YBL079W = 0006407
+YBL079W = 0006408
+YBL079W = 0006409
+YBL079W = 0006607
+YBL079W = 0006608
+YBL079W = 0006609
+YBL079W = 0006610
+YBL079W = 0006611
+YBL079W = 0006999
+YML103C = 0006406
+YML103C = 0006407
+YML103C = 0006408
+YML103C = 0006409
+YML103C = 0006607
+YML103C = 0006608
+YML103C = 0006609
+YML103C = 0006610
+YML103C = 0006611
+YML103C = 0006999
+YJL039C = 0006999
+YJL039C = 0006999
+YLR335W = 0006406
+YLR335W = 0006407
+YLR335W = 0006408
+YLR335W = 0006409
+YLR335W = 0006607
+YLR335W = 0006608
+YLR335W = 0006609
+YLR335W = 0006610
+YLR335W = 0006611
+YLR335W = 0006999
+YDR192C = 0006406
+YDR192C = 0006407
+YDR192C = 0006408
+YDR192C = 0006409
+YDR192C = 0006607
+YDR192C = 0006608
+YDR192C = 0006609
+YDR192C = 0006610
+YDR192C = 0006611
+YDR192C = 0006999
+YGL172W = 0000055
+YGL172W = 0006388
+YGL172W = 0006406
+YGL172W = 0006407
+YGL172W = 0006408
+YGL172W = 0006409
+YGL172W = 0006606
+YGL172W = 0006607
+YGL172W = 0006608
+YGL172W = 0006609
+YGL172W = 0006610
+YGL172W = 0006611
+YGL172W = 0006999
+YMR153W = 0000059
+YMR153W = 0006406
+YMR153W = 0006407
+YMR153W = 0006408
+YMR153W = 0006409
+YMR153W = 0006607
+YMR153W = 0006608
+YMR153W = 0006609
+YMR153W = 0006610
+YMR153W = 0006611
+YMR153W = 0006999
+YGR119C = 0006406
+YGR119C = 0006407
+YGR119C = 0006408
+YGR119C = 0006409
+YGR119C = 0006606
+YGR119C = 0006607
+YGR119C = 0006608
+YGR119C = 0006609
+YGR119C = 0006610
+YGR119C = 0006611
+YGR119C = 0006999
+YAR002W = 0006913
+YAR002W = 0000059
+YAR002W = 0000059
+YJL061W = 0006406
+YJL061W = 0006407
+YJL061W = 0006408
+YJL061W = 0006409
+YJL061W = 0006607
+YJL061W = 0006608
+YJL061W = 0006609
+YJL061W = 0006610
+YJL061W = 0006611
+YJL061W = 0006999
+YDL116W = 0006406
+YDL116W = 0006407
+YDL116W = 0006408
+YDL116W = 0006409
+YDL116W = 0006607
+YDL116W = 0006608
+YDL116W = 0006609
+YDL116W = 0006610
+YDL116W = 0006611
+YDL116W = 0006998
+YDL116W = 0006999
+YJR042W = 0006406
+YJR042W = 0006407
+YJR042W = 0006408
+YJR042W = 0006409
+YJR042W = 0006607
+YJR042W = 0006608
+YJR042W = 0006609
+YJR042W = 0006610
+YJR042W = 0006611
+YJR042W = 0006998
+YJR042W = 0006999
+YGL151W = 0006357
+YPR168W = 0006366
+YHR195W = 0000004
+YLR093C = 0006906
+YKL120W = 0015729
+YKL120W = 0008272
+YAL051W = 0006356
+YKL055C = 0009060
+YKL055C = 0006631
+YKL055C = 0006631
+YNL099C = 0006979
+YGL038C = 0006492
+YKL134C = 0006627
+YKL134C = 0006879
+YKL134C = 0006879
+YPL134C = 0006839
+YOR222W = 0006839
+YML060W = 0006285
+YML060W = 0006281
+YGR179C = 0007059
+YGL055W = 0000001
+YGL055W = 0006636
+YGL055W = 0006636
+Q0130 = 0015986
+YIL136W = 0000004
+YHL020C = 0008654
+YHL020C = 0000122
+YJR073C = 0006656
+YJL212C = 0006790
+YPR194C = 0006857
+YBR129C = 0000747
+YPR075C = 0000751
+YML065W = 0006267
+YML065W = 0006270
+YML065W = 0006347
+YBR060C = 0006267
+YBR060C = 0006270
+YBR060C = 0006347
+YLL004W = 0006267
+YLL004W = 0006270
+YLL004W = 0006347
+YPR162C = 0006267
+YPR162C = 0006270
+YPR162C = 0006347
+YNL261W = 0006267
+YNL261W = 0006270
+YNL261W = 0006347
+YHR118C = 0006267
+YHR118C = 0006270
+YHR118C = 0006347
+YGR038W = 0000004
+YLR350W = 0000004
+YOR130C = 0006526
+YOR130C = 0000065
+YAR044W = 0006694
+YAR044W = 0006694
+YDL019C = 0006694
+YDL019C = 0006694
+YHR073W = 0006694
+YHR073W = 0006694
+YKR003W = 0006694
+YKR003W = 0006694
+YHR001W = 0006694
+YHR001W = 0006694
+YJR051W = 0008152
+YJL002C = 0006487
+YJL002C = 0018279
+YOR103C = 0006487
+YOR103C = 0006487
+YOR085W = 0006487
+YOR085W = 0006461
+YOR085W = 0006486
+YDL232W = 0006487
+YDL232W = 0006487
+YGL226C-A = 0006487
+YML019W = 0006461
+YML019W = 0018279
+YML019W = 0018279
+YER154W = 0006628
+YER154W = 0006628
+YPL196W = 0006979
+YHR179W = 0000004
+YHR179W = 0000004
+YPL171C = 0000004
+YER165W = 0006446
+YER165W = 0006446
+YOR269W = 0030473
+YGR078C = 0007021
+YGR078C = 0007021
+YDR488C = 0007017
+YER007W = 0007023
+YER007W = 0007024
+YDR538W = 0019439
+YBR279W = 0006368
+YMR174C = 0007039
+YER129W = 0006261
+YER129W = 0006468
+YDR251W = 0007124
+YIR006C = 0016288
+YIR006C = 0000147
+YIR006C = 0006897
+YIR006C = 0007120
+YIR006C = 0007121
+YGL094C = 0006397
+YGL094C = 0006397
+YGL094C = 0006301
+YGL094C = 0006301
+YKL025C = 0006281
+YKL025C = 0006301
+YKL025C = 0006301
+YHR063C = 0000004
+YIL145C = 0015940
+YKR002W = 0006378
+YKR002W = 0006378
+YCR077C = 0007059
+YCR077C = 0006446
+YCR077C = 0006446
+YJL223C = 0000004
+YEL049W = 0000004
+YCR104W = 0000004
+YLR461W = 0000004
+YFL020C = 0000004
+YNR076W = 0000004
+YAR020C = 0000004
+YNL015W = 0030162
+YNL015W = 0042144
+YCL052C = 0016485
+YGR178C = 0006378
+YGR178C = 0006378
+YGR178C = 0006378
+YBR233W = 0000004
+YJL128C = 0000169
+YJL128C = 0006468
+YJL128C = 0007231
+YJL128C = 0007015
+YBR295W = 0006878
+YLR151C = 0000004
+YDR228C = 0006379
+YDR228C = 0006378
+YBR186W = 0040020
+YIL071C = 0000338
+YKR097W = 0006094
+YNL289W = 0007049
+YGL134W = 0005981
+YGL134W = 0005979
+YGL134W = 0005979
+YDL127W = 0007049
+YHR071W = 0007049
+YER059W = 0005979
+YER059W = 0005981
+YIL050W = 0005979
+YIL050W = 0005981
+YPL219W = 0005981
+YPL219W = 0005979
+YPL219W = 0005979
+YDL179W = 0007049
+YEL058W = 0006045
+YGR101W = 0007005
+YGR101W = 0045041
+YGR202C = 0006656
+YGR202C = 0006657
+YER178W = 0006090
+YBR221C = 0006090
+YLR044C = 0019655
+YLR044C = 0006090
+YDR081C = 0009228
+YDR081C = 0006366
+YDR081C = 0019655
+YLR134W = 0019655
+YLR134W = 0006090
+YGR087C = 0006067
+YGL248W = 0019933
+YOR360C = 0019933
+YPR002W = 0019541
+YCL043C = 0006457
+YCL043C = 0006466
+YGL013C = 0006357
+YGL013C = 0042493
+YOR328W = 0006855
+YOR328W = 0006855
+YIL013C = 0015918
+YPL058C = 0019541
+YPL058C = 0006810
+YDR406W = 0006810
+YNL231C = 0015914
+YNL231C = 0016126
+YNL231C = 0042493
+YNL264C = 0008654
+YNL264C = 0015914
+YNL264C = 0042493
+YNR070W = 0000004
+YBL005W = 0006357
+YBL005W = 0042493
+YOR153W = 0015893
+YOR153W = 0042493
+YLR266C = 0000004
+YDR113C = 0006606
+YDR113C = 0016359
+YDR113C = 0016359
+YMR076C = 0007064
+YMR076C = 0007076
+YGR193C = 0006086
+YBR035C = 0006631
+YER149C = 0007015
+YER149C = 0007121
+YER149C = 0007266
+YER149C = 0000283
+YER149C = 0000283
+YBL017C = 0006623
+YBL017C = 0006623
+YBL017C = 0007034
+YBL017C = 0007034
+YOR036W = 0006896
+YLR148W = 0006904
+YLR148W = 0042145
+YLR148W = 0006895
+YLR148W = 0045324
+YPL154C = 0007039
+YPL154C = 0030435
+YPL154C = 0009267
+YPL154C = 0007039
+YMR231W = 0006904
+YMR231W = 0042145
+YMR231W = 0006895
+YMR231W = 0045324
+YDR323C = 0006896
+YDR323C = 0006896
+YDR323C = 0006904
+YDR323C = 0006906
+YJL053W = 0045053
+YJL053W = 0042147
+YCR044C = 0006986
+YFR023W = 0006261
+YKR046C = 0000004
+YDR079W = 0008535
+YDR079W = 0009060
+YMR257C = 0006412
+YBL080C = 0006412
+YBL080C = 0007005
+YBL080C = 0009060
+YER058W = 0008535
+YER153C = 0006412
+YOR158W = 0006412
+YOR158W = 0006412
+YOR017W = 0006396
+YJL023C = 0000004
+YCR020C = 0007005
+YCR020C = 0006772
+YJR034W = 0008535
+YLR067C = 0006412
+YLR067C = 0016070
+YLR067C = 0009060
+YNR045W = 0006412
+YGR222W = 0006412
+YGR222W = 0006371
+YOR201C = 0000027
+YNL003C = 0006810
+YBL030C = 0006854
+YKL197C = 0007031
+YDR265W = 0007031
+YOL147C = 0007031
+YMR026C = 0007031
+YLR191W = 0007031
+YLR191W = 0006625
+YLR191W = 0006625
+YGL153W = 0006625
+YGL153W = 0006625
+YGL153W = 0006625
+YOL044W = 0006625
+YOL044W = 0007031
+YNL214W = 0007031
+YHR160C = 0006625
+YHR160C = 0006625
+YDL065C = 0006625
+YDL065C = 0007031
+YDL065C = 0007031
+YJL210W = 0007031
+YGR239C = 0006625
+YGR239C = 0006625
+YAL055W = 0006625
+YPL112C = 0007031
+YPL112C = 0007031
+YPL112C = 0007031
+YDR329C = 0007031
+YDR329C = 0006625
+YGR133W = 0007031
+YGR133W = 0000209
+YGR133W = 0006513
+YGR133W = 0007031
+YDR244W = 0007031
+YDR244W = 0006625
+YNL329C = 0007031
+YDR142C = 0007031
+YDR142C = 0006625
+YGR077C = 0007031
+YGR077C = 0006625
+YJL179W = 0006457
+YJL179W = 0006457
+YJL179W = 0007010
+YGR240C = 0006096
+YMR205C = 0006096
+YIL107C = 0006003
+YIL107C = 0006110
+YOL136C = 0006003
+YOL136C = 0006110
+YHR185C = 0030476
+YNL317W = 0006378
+YNL317W = 0006378
+YNL317W = 0006379
+YNL317W = 0006379
+YNL317W = 0006379
+YNL317W = 0006378
+YOR122C = 0006970
+YOR122C = 0007120
+YOR122C = 0007121
+YOR122C = 0008154
+YGL025C = 0006366
+YBR196C = 0006094
+YBR196C = 0006098
+YBR196C = 0006096
+YCR012W = 0006094
+YCR012W = 0006096
+YKL127W = 0006008
+YKL127W = 0006008
+YKL127W = 0006010
+YKL127W = 0006010
+YKL127W = 0005977
+YKL127W = 0005992
+YKL127W = 0006012
+YMR105C = 0006008
+YMR105C = 0006008
+YMR105C = 0006010
+YMR105C = 0006010
+YMR105C = 0005977
+YMR105C = 0005992
+YMR105C = 0006012
+YCL004W = 0008654
+YJR153W = 0007124
+YJR153W = 0045490
+YNL316C = 0019274
+YGR132C = 0006508
+YGR132C = 0006508
+YGR132C = 0007569
+YGR231C = 0006508
+YGR231C = 0006508
+YGR231C = 0007569
+YKL043W = 0007124
+YDR281C = 0000004
+YOL084W = 0000004
+YER037W = 0000004
+YAR071W = 0006796
+YHR215W = 0000004
+YDL236W = 0016576
+YDL236W = 0006470
+YDL106C = 0000105
+YDL106C = 0009113
+YDL106C = 0016036
+YNL097C = 0016568
+YNL097C = 0016568
+YNL097C = 0016568
+YBR092C = 0015888
+YOL002C = 0000004
+YFR034C = 0006796
+YFR034C = 0016036
+YFR034C = 0016036
+YBR093C = 0006796
+YBR093C = 0016036
+YDR481C = 0016576
+YDR481C = 0006470
+YOL001W = 0019220
+YGR233C = 0006796
+YML123C = 0006817
+YML123C = 0006817
+YPL031C = 0006468
+YPL031C = 0006796
+YPL031C = 0006468
+YPL031C = 0006468
+YPL031C = 0007049
+YPL031C = 0007049
+YPL031C = 0005977
+YPL031C = 0005977
+YPL031C = 0005977
+YPL031C = 0005977
+YPL031C = 0005977
+YPL031C = 0005977
+YJL117W = 0045045
+YJL117W = 0006817
+YCR037C = 0006817
+YCR037C = 0006817
+YCR037C = 0006817
+YBR106W = 0006817
+YBR106W = 0006817
+YBR106W = 0006817
+YBR296C = 0006817
+YJL198W = 0006817
+YNR013C = 0006817
+YOR386W = 0000719
+YDR313C = 0016567
+YGL023C = 0016192
+YML061C = 0006310
+YML061C = 0007001
+YLR273C = 0005979
+YIL045W = 0000004
+YNL267W = 0016288
+YNL267W = 0006892
+YNL267W = 0007165
+YGR086C = 0000004
+YBL022C = 0006508
+YBL022C = 0009408
+YOR104W = 0000004
+YPR154W = 0000004
+YBL051C = 0000004
+YOR363C = 0006357
+YOR363C = 0006357
+YKL164C = 0007047
+YKL163W = 0007047
+YPR113W = 0006661
+YBL105C = 0006468
+YBL105C = 0007047
+YBL105C = 0007165
+YBL105C = 0007243
+YDR490C = 0006468
+YDR490C = 0006897
+YDR490C = 0000196
+YDR490C = 0000196
+YOL100W = 0006468
+YOL100W = 0000196
+YOL100W = 0000196
+YMR123W = 0000004
+YMR008C = 0006650
+YMR006C = 0006650
+YMR006C = 0006650
+YMR006C = 0006650
+YOL011W = 0030384
+YOL011W = 0030384
+YOL011W = 0006660
+YOL011W = 0006660
+YPL268W = 0007124
+YPL268W = 0007165
+YPL268W = 0008151
+YDR501W = 0000004
+YPR179C = 0000004
+YDR295C = 0000004
+YDR183W = 0007329
+YDR183W = 0007329
+YOR281C = 0007329
+YOR281C = 0007329
+YGL008C = 0015992
+YGL008C = 0006885
+YPL036W = 0015992
+YPL036W = 0006885
+YGL006W = 0006816
+YGL006W = 0006816
+YGL006W = 0006874
+YER132C = 0030435
+YER132C = 0030435
+YER003C = 0000032
+YER003C = 0006486
+YER003C = 0009298
+YCR024C-A = 0006812
+YEL017C-A = 0006812
+YDR276C = 0006812
+YGL167C = 0045045
+YNL082W = 0006298
+YNL082W = 0007126
+YDL095W = 0006493
+YDL095W = 0006493
+YAL023C = 0006493
+YAL023C = 0006493
+YOR321W = 0006493
+YOR321W = 0006493
+YJR143C = 0006493
+YJR143C = 0006493
+YDL093W = 0006493
+YGR199W = 0006493
+YKL128C = 0000004
+YGL037C = 0019358
+YGL037C = 0000183
+YGL037C = 0006348
+YPL096W = 0006515
+YPL096W = 0006517
+YLR209C = 0006152
+YOR266W = 0007007
+YML069W = 0006261
+YML069W = 0006333
+YML069W = 0006338
+YIL122W = 0000321
+YIL122W = 0000321
+YNL102W = 0006269
+YNL102W = 0006270
+YNL102W = 0006273
+YNL102W = 0000731
+YBL035C = 0006269
+YBL035C = 0006270
+YBL035C = 0006273
+YNL262W = 0006272
+YNL262W = 0006273
+YNL262W = 0006289
+YNL262W = 0006298
+YNL262W = 0000731
+YBR088C = 0006272
+YBR088C = 0006273
+YBR088C = 0006280
+YBR088C = 0006284
+YBR088C = 0006289
+YBR088C = 0006298
+YBR088C = 0006298
+YBR088C = 0006301
+YJR043C = 0006272
+YJR043C = 0006273
+YJR043C = 0006280
+YJR043C = 0006284
+YJR043C = 0006289
+YJR043C = 0006298
+YJR043C = 0006298
+YJR043C = 0006301
+YCR014C = 0006302
+YCR014C = 0006287
+YEL055C = 0006261
+YMR129W = 0006406
+YMR129W = 0006407
+YMR129W = 0006408
+YMR129W = 0006409
+YMR129W = 0006607
+YMR129W = 0006608
+YMR129W = 0006609
+YMR129W = 0006610
+YMR129W = 0006611
+YMR129W = 0006999
+YLR018C = 0006913
+YNL221C = 0006364
+YNL221C = 0008033
+YNR052C = 0006357
+YNR052C = 0000289
+YNL282W = 0006364
+YNL282W = 0008033
+YBR257W = 0006364
+YBR257W = 0008033
+YAL033W = 0006364
+YAL033W = 0008033
+YGR030C = 0006364
+YGR030C = 0008033
+YBR167C = 0006364
+YBR167C = 0008033
+YBL018C = 0006364
+YBL018C = 0008033
+YNL055C = 0007005
+YNL055C = 0009060
+YNL055C = 0006811
+YIL114C = 0006811
+YIL114C = 0006811
+YPL188W = 0006979
+YIL160C = 0006635
+YGL205W = 0006635
+YHR026W = 0007035
+YHR026W = 0007035
+YMR267W = 0007585
+YHR075C = 0006464
+YNR032W = 0006470
+YNR032W = 0005977
+YDL134C = 0006412
+YDL134C = 0007015
+YDL134C = 0007094
+YDL134C = 0007117
+YDL188C = 0006412
+YDL188C = 0007015
+YDL188C = 0007094
+YDL188C = 0007117
+YDR075W = 0006470
+YDR075W = 0006807
+YDR435C = 0006481
+YOL141W = 0000004
+YDR452W = 0006797
+YDR452W = 0006797
+YPL179W = 0006470
+YPL179W = 0006445
+YLR014C = 0006355
+YLR014C = 0046107
+YBR276C = 0007090
+YBR276C = 0007090
+YBR276C = 0006774
+YBR276C = 0006774
+YGR123C = 0006468
+YPL148C = 0018065
+YHR201C = 0006797
+YML016C = 0006883
+YML016C = 0006883
+YDR436W = 0006883
+YDR436W = 0006883
+YEL060C = 0007039
+YEL060C = 0007039
+YEL060C = 0009267
+YEL060C = 0030435
+YMR297W = 0007039
+YCL057W = 0006508
+YCL057W = 0006508
+YER012W = 0006511
+YER012W = 0006511
+YER012W = 0006950
+YER012W = 0007151
+YOR362C = 0006511
+YOR362C = 0006511
+YPR103W = 0006511
+YPR103W = 0006511
+YJL001W = 0006511
+YJL001W = 0006511
+YJL001W = 0006950
+YJL001W = 0007151
+YFR050C = 0006511
+YFR050C = 0006511
+YMR314W = 0006511
+YMR314W = 0006511
+YOL038W = 0006511
+YOL038W = 0006511
+YBL041W = 0006511
+YBL041W = 0006511
+YML092C = 0006511
+YML092C = 0006511
+YGR135W = 0006511
+YGR135W = 0006511
+YIR008C = 0006269
+YIR008C = 0006270
+YIR008C = 0006273
+YKL045W = 0006269
+YKL045W = 0006270
+YKL045W = 0006273
+YKL045W = 0000731
+YIL095W = 0016288
+YIL095W = 0000147
+YIL095W = 0006468
+YIL095W = 0007015
+YNL279W = 0045026
+YNL279W = 0045026
+YJL108C = 0000747
+YIL037C = 0000747
+YPL192C = 0000747
+YPL156C = 0000747
+YIL117C = 0000747
+YML047C = 0000747
+YDL039C = 0000747
+YGL053W = 0000747
+YAR031W = 0000747
+YDR300C = 0006561
+YOR323C = 0006561
+YER023W = 0006561
+YER023W = 0006561
+YER023W = 0006561
+YDL043C = 0000245
+YMR302C = 0000002
+YMR302C = 0006364
+YKR086W = 0006373
+YGR006W = 0006371
+YLL036C = 0006371
+YLL036C = 0006371
+YNR011C = 0006372
+YJL203W = 0006371
+YER013W = 0006372
+YMR268C = 0000244
+YMR268C = 0000245
+YDR243C = 0006372
+YDR473C = 0006371
+YGR091W = 0006371
+YGR075C = 0006371
+YML046W = 0006371
+YPR178W = 0006371
+YKL012W = 0006371
+YDR235W = 0006371
+YGL120C = 0006372
+YAL032C = 0045944
+YPL151C = 0006371
+YBR237W = 0006372
+YBR055C = 0006371
+YHR165C = 0006371
+YDL030W = 0006371
+YKL116C = 0000165
+YDL214C = 0000165
+YKL181W = 0000105
+YKL181W = 0000162
+YKL181W = 0006166
+YKL181W = 0006189
+YKL181W = 0006207
+YER099C = 0000105
+YER099C = 0000162
+YER099C = 0006166
+YER099C = 0006189
+YER099C = 0006207
+YHL011C = 0000105
+YHL011C = 0000162
+YHL011C = 0006166
+YHL011C = 0006189
+YHL011C = 0006207
+YHL011C = 0008361
+YBL068W = 0000105
+YBL068W = 0000162
+YBL068W = 0006166
+YBL068W = 0006189
+YBL068W = 0006207
+YOL061W = 0000105
+YOL061W = 0000162
+YOL061W = 0006166
+YOL061W = 0006189
+YOL061W = 0006207
+YOR361C = 0006413
+YOR361C = 0006413
+YJL079C = 0000004
+YKR013W = 0000004
+YJL078C = 0000004
+YDL055C = 0006486
+YDL055C = 0009298
+YDL055C = 0009298
+YDL055C = 0000032
+YNL169C = 0006656
+YGR170W = 0006656
+YMR308C = 0006406
+YOL054W = 0006368
+YAL017W = 0000004
+YOL045W = 0000004
+YMR137C = 0006281
+YDR505C = 0000004
+YML017W = 0000004
+YLL010C = 0006950
+YLR019W = 0006950
+YDR055W = 0000004
+YDR032C = 0000004
+YKL076C = 0000004
+YNL201C = 0000004
+YLR376C = 0000004
+YAL043C = 0006379
+YAL043C = 0006379
+YAL043C = 0006378
+YAL043C = 0006378
+YAL043C = 0008033
+YDL006W = 0006470
+YDL006W = 0006970
+YDL006W = 0000001
+YDL006W = 0006388
+YER089C = 0000079
+YER089C = 0000079
+YER089C = 0006470
+YER089C = 0000173
+YER089C = 0006986
+YER089C = 0006986
+YER089C = 0000077
+YBL056W = 0000079
+YBL056W = 0000079
+YBL056W = 0000173
+YBL056W = 0006470
+YBR125C = 0000004
+YOR090C = 0000004
+YHR076W = 0000004
+YHR189W = 0006412
+YHR189W = 0006412
+YBL057C = 0006412
+YGR156W = 0006378
+YGR156W = 0006378
+YGR156W = 0006379
+YGR156W = 0006379
+YKL198C = 0015846
+YKL198C = 0015846
+YJR059W = 0006873
+YJR059W = 0006873
+YJR059W = 0015846
+YJR059W = 0015846
+YKL039W = 0000004
+YDL230W = 0006470
+YDL230W = 0006470
+YOR208W = 0000173
+YOR208W = 0006470
+YOR208W = 0007231
+YOR208W = 0000750
+YER075C = 0000750
+YER075C = 0000750
+YER075C = 0006470
+YER075C = 0006470
+YER075C = 0000173
+YER075C = 0000173
+YKR093W = 0015833
+YFR029W = 0007606
+YFR029W = 0007606
+YNL016W = 0000184
+YPR042C = 0000288
+YLL013C = 0000288
+YGL014W = 0007569
+YGL014W = 0007569
+YGL014W = 0006605
+YGL014W = 0000288
+YDR496C = 0000004
+YOR157C = 0006511
+YOR157C = 0006511
+YGR253C = 0006511
+YGR253C = 0006511
+YGR253C = 0006950
+YGR253C = 0007151
+YER094C = 0006511
+YER094C = 0006511
+YPL212C = 0006400
+YGL063W = 0006400
+YNL292W = 0006400
+YLR165C = 0001522
+YLR165C = 0000154
+YGR169C = 0001522
+YGR169C = 0006400
+YOR243C = 0000004
+YLR142W = 0006537
+YLR142W = 0006562
+YHR037W = 0006537
+YHR037W = 0006562
+YKL015W = 0045944
+YKL015W = 0006562
+YOR348C = 0015804
+YLR196W = 0000004
+YCR057C = 0016288
+YCR057C = 0000283
+YCR057C = 0030490
+YCR057C = 0030490
+YPL147W = 0015908
+YKL188C = 0015908
+YKR090W = 0000004
+YGR280C = 0006365
+YGR280C = 0016180
+YGL062W = 0006740
+YGL062W = 0006094
+YBR218C = 0006740
+YBR218C = 0006094
+YOR347C = 0006090
+YOR347C = 0006096
+YPR186C = 0006384
+YPR186C = 0006384
+YHR001W-A = 0009060
+YHR001W-A = 0006122
+YPR191W = 0009060
+YPR191W = 0006122
+YFR033C = 0009060
+YFR033C = 0006122
+YDR529C = 0009060
+YDR529C = 0006122
+YDR529C = 0017062
+YJL166W = 0009060
+YJL166W = 0006122
+YGR183C = 0009060
+YGR183C = 0006122
+YGR183C = 0016226
+YIL120W = 0006855
+YHR074W = 0000004
+YDL103C = 0006048
+YDL105W = 0000004
+YLR204W = 0000004
+YDL104C = 0000004
+YMR022W = 0030433
+YPL246C = 0000004
+YPL022W = 0006296
+YPL022W = 0000735
+YPL022W = 0000736
+YML095C = 0006281
+YML095C = 0006296
+YML095C = 0000735
+YML095C = 0000736
+YMR201C = 0000715
+YBR114W = 0000715
+YOR368W = 0007131
+YOR368W = 0000077
+YCR066W = 0006281
+YGR258C = 0006295
+YEL037C = 0000715
+YER173W = 0006289
+YER173W = 0007131
+YER173W = 0000077
+YJR035W = 0006283
+YJR035W = 0006289
+YKL113C = 0006260
+YKL113C = 0006281
+YKL113C = 0000731
+YDR030C = 0006281
+YER171W = 0006367
+YER171W = 0006367
+YER171W = 0007070
+YER171W = 0000717
+YDR419W = 0006281
+YER162C = 0000715
+YLR032W = 0006281
+YNL250W = 0042138
+YNL250W = 0000706
+YNL250W = 0000727
+YNL250W = 0000722
+YER095W = 0045003
+YER095W = 0000709
+YER095W = 0042148
+YER095W = 0030491
+YER095W = 0000727
+YER095W = 0000722
+YER095W = 0045002
+YML032C = 0000707
+YML032C = 0045003
+YML032C = 0000730
+YML032C = 0000730
+YML032C = 0000727
+YML032C = 0000722
+YML032C = 0045002
+YPL153C = 0006139
+YPL153C = 0006281
+YGL163C = 0045003
+YGL163C = 0030491
+YGL163C = 0000727
+YGL163C = 0000722
+YGL163C = 0045002
+YDR076W = 0000707
+YDR076W = 0000730
+YDR076W = 0045003
+YDR076W = 0000730
+YDR076W = 0000727
+YDR076W = 0045002
+YDR004W = 0000707
+YDR004W = 0045003
+YDR004W = 0000730
+YDR004W = 0000730
+YDR004W = 0000727
+YDR004W = 0000722
+YDR004W = 0045002
+YDL059C = 0000727
+YDL059C = 0000722
+YDL059C = 0045002
+YGL058W = 0006281
+YGL058W = 0006511
+YDR014W = 0000004
+YJR052W = 0000715
+YDR217C = 0006281
+YDR217C = 0006281
+YDR217C = 0000074
+YDR217C = 0000074
+YDR217C = 0006289
+YDR217C = 0000077
+YGL246C = 0030489
+YGL246C = 0006401
+YDL090C = 0018347
+YKL019W = 0007323
+YNL216W = 0006342
+YNL216W = 0006383
+YNL216W = 0007004
+YNL216W = 0006348
+YOR101W = 0007189
+YOR101W = 0007265
+YOR101W = 0008283
+YNL098C = 0007124
+YNL098C = 0007151
+YNL098C = 0007190
+YNL098C = 0007265
+YOR048C = 0006364
+YOR048C = 0006396
+YJR033C = 0007035
+YJR033C = 0007035
+YJR033C = 0007035
+YDR202C = 0007035
+YDR202C = 0007035
+YDR202C = 0007035
+YOR301W = 0000282
+YLR084C = 0000282
+YLR084C = 0000282
+YCR036W = 0006014
+YOR265W = 0007023
+YOR265W = 0007025
+YDL189W = 0000004
+YMR274C = 0016485
+YMR274C = 0007323
+YGL158W = 0006468
+YGL158W = 0040020
+YGL158W = 0040020
+YLR248W = 0006468
+YLR248W = 0040020
+YLR248W = 0040020
+YOL010W = 0006364
+YKL159C = 0019722
+YMR075W = 0000004
+YGL071W = 0045944
+YGL071W = 0045944
+YGL071W = 0006827
+YGL071W = 0006827
+YJL204C = 0006897
+YJL204C = 0006897
+YBR073W = 0007131
+YBR073W = 0007131
+YBR073W = 0007131
+YBR073W = 0007131
+YBR073W = 0000727
+YBR073W = 0030491
+YDL135C = 0007264
+YDL135C = 0007015
+YDL135C = 0007015
+RDN18-1 = 0006412
+RDN18-2 = 0006412
+RDN25-1 = 0006412
+RDN25-2 = 0006412
+RDN5-1 = 0006412
+RDN5-2 = 0006412
+RDN5-3 = 0006412
+RDN58-1 = 0006412
+RDN58-2 = 0006412
+YOR380W = 0009410
+YCR106W = 0009410
+YPL133C = 0009410
+YPR094W = 0009410
+YBR049C = 0006357
+YBR049C = 0006363
+YLR329W = 0007131
+YLR329W = 0042138
+YHR157W = 0007131
+YHR157W = 0042138
+YJR021C = 0007131
+YMR133W = 0007131
+YMR133W = 0042138
+YLR263W = 0007130
+YLR263W = 0007130
+YLR263W = 0007130
+YDR195W = 0006397
+YDR195W = 0006397
+YDR195W = 0006397
+YDR028C = 0000122
+YDR028C = 0005977
+YDR028C = 0008151
+YBR050C = 0008151
+YBR050C = 0000122
+YCL001W = 0006888
+YBR002C = 0006486
+YBR002C = 0006486
+YBR002C = 0019408
+YOR207C = 0006383
+YFR051C = 0006890
+YFR051C = 0006888
+YPL010W = 0006890
+YOR346W = 0006261
+YOR346W = 0006281
+YPL167C = 0006280
+YPL167C = 0006281
+YIL139C = 0006280
+YIL139C = 0006281
+YLR059C = 0006396
+YLR107W = 0006396
+YOL080C = 0006364
+YOL080C = 0042255
+YAR007C = 0006268
+YAR007C = 0006269
+YAR007C = 0006271
+YAR007C = 0006289
+YAR007C = 0006301
+YAR007C = 0006302
+YAR007C = 0006310
+YNL312W = 0006268
+YNL312W = 0006269
+YNL312W = 0006271
+YNL312W = 0006289
+YNL312W = 0006301
+YNL312W = 0006302
+YNL312W = 0006310
+YJL173C = 0006268
+YJL173C = 0006269
+YJL173C = 0006271
+YJL173C = 0006289
+YJL173C = 0006301
+YJL173C = 0006302
+YJL173C = 0006310
+YOR217W = 0006272
+YOR217W = 0006298
+YJR068W = 0006272
+YJR068W = 0006298
+YJR068W = 0007062
+YNL290W = 0006272
+YNL290W = 0006298
+YNL290W = 0007062
+YOL094C = 0006272
+YOL094C = 0006298
+YOL094C = 0007062
+YBR087W = 0006272
+YBR087W = 0006298
+YBR087W = 0007062
+YOR279C = 0000004
+YBL020W = 0006487
+YBL020W = 0015772
+YLR176C = 0000122
+YLR176C = 0000077
+YOR127W = 0007118
+YOR127W = 0007119
+YOR127W = 0007124
+YOR127W = 0007125
+YOR127W = 0007264
+YOR127W = 0000283
+YOR127W = 0000750
+YOR127W = 0007015
+YDR379W = 0007118
+YDR379W = 0007119
+YDR379W = 0007124
+YDR379W = 0007125
+YDR379W = 0007264
+YDR379W = 0000283
+YDR379W = 0000750
+YDR379W = 0007015
+YBR260C = 0007231
+YFL047W = 0007264
+YFL047W = 0007264
+YMR182C = 0000122
+YDR137W = 0006886
+YDR137W = 0006886
+YLR071C = 0006366
+YOR107W = 0007188
+YKL038W = 0006006
+YDL138W = 0007165
+YDL138W = 0009749
+YCR027C = 0015809
+YCR027C = 0015809
+YCR027C = 0015819
+YLR383W = 0006281
+YLR383W = 0008283
+YBL082C = 0006488
+YBL082C = 0006486
+YPR165W = 0007047
+YPR165W = 0007117
+YPR165W = 0007264
+YPR165W = 0000283
+YPR165W = 0007015
+YNL090W = 0007017
+YNL090W = 0007047
+YNL090W = 0007264
+YNL090W = 0000283
+YNL090W = 0007015
+YIL118W = 0006887
+YIL118W = 0007264
+YIL118W = 0000283
+YIL118W = 0000283
+YIL118W = 0000283
+YIL118W = 0007015
+YKR055W = 0007264
+YKR055W = 0000283
+YKR055W = 0000283
+YKR055W = 0000283
+YKR055W = 0007015
+YNL180C = 0007266
+YIL053W = 0006071
+YIL053W = 0006970
+YIL053W = 0006114
+YNL163C = 0007046
+YNL163C = 0007046
+YNL163C = 0007046
+YBL033C = 0009231
+YBL033C = 0009231
+YOL066C = 0009231
+YDR487C = 0009231
+YOL143C = 0009231
+YOL143C = 0009231
+YBR256C = 0009231
+YBR153W = 0009231
+YLR039C = 0006886
+YLR039C = 0006886
+YBR275C = 0006348
+YBR275C = 0007004
+YLR453C = 0007004
+YCR028C-A = 0000002
+YHL027W = 0006350
+YHL027W = 0007126
+YHL027W = 0007151
+YHL027W = 0009268
+YMR139W = 0006468
+YMR139W = 0006468
+YMR139W = 0006508
+YMR139W = 0007151
+YMR154C = 0016485
+YMR154C = 0016485
+YFL033C = 0006468
+YFL033C = 0040020
+YFL033C = 0006950
+YBR192W = 0000002
+YOR275C = 0016485
+YOR275C = 0016485
+YOR275C = 0016485
+YOR275C = 0006508
+YOR275C = 0030435
+YOR275C = 0007125
+YNL294C = 0007151
+YNL294C = 0007125
+YHL024W = 0030435
+YHL024W = 0030435
+YHL024W = 0007126
+YHL024W = 0006279
+YHL024W = 0007126
+YHL024W = 0007131
+YGL045W = 0016485
+YGL045W = 0007126
+YGL045W = 0007125
+YMR063W = 0007151
+YOR119C = 0030490
+YOR119C = 0007096
+YOR119C = 0000084
+YNL207W = 0000004
+YEL024W = 0009060
+YEL024W = 0006122
+YOR191W = 0006333
+YOR191W = 0006333
+YOR191W = 0007533
+YOR191W = 0006333
+YMR283C = 0019988
+YMR283C = 0019988
+YOR095C = 0006098
+YPR018W = 0006334
+YDR091C = 0000004
+YPL089C = 0007165
+YLR009W = 0042273
+YLR009W = 0042273
+YNL002C = 0030489
+YNL002C = 0042273
+YNL139C = 0006368
+YDL001W = 0000004
+YHL023C = 0000004
+YHR067W = 0000004
+YDR255C = 0000004
+YEL072W = 0000004
+YER083C = 0007047
+YER083C = 0007047
+YFR048W = 0000004
+YGL107C = 0000004
+YGR044C = 0000122
+YGR044C = 0007126
+YEL050C = 0006412
+YEL050C = 0006631
+YDR257C = 0000004
+YDR465C = 0018216
+YMR235C = 0006407
+YMR235C = 0000054
+YMR061W = 0006379
+YMR061W = 0006378
+YGL044C = 0006379
+YGL044C = 0006378
+YMR234W = 0006260
+YMR234W = 0007047
+YNL072W = 0006260
+YGR276C = 0006260
+YGR276C = 0006396
+YLL046C = 0042254
+YCL028W = 0000004
+YER070W = 0006260
+YJL026W = 0006260
+YIL066C = 0006260
+YGR180C = 0006260
+YMR239C = 0006365
+YPL123C = 0000902
+YOR018W = 0042493
+YGL171W = 0006365
+YGL171W = 0006371
+YGR070W = 0007047
+YGR070W = 0007117
+YGR070W = 0007264
+YGR070W = 0000283
+YGR070W = 0007015
+YLR371W = 0007047
+YLR371W = 0007117
+YLR371W = 0007264
+YLR371W = 0000283
+YLR371W = 0007015
+YMR200W = 0007047
+YBR229C = 0009272
+YPR065W = 0000122
+YBL093C = 0006366
+YJR063W = 0006360
+YPR010C = 0006360
+YDR156W = 0006360
+YOR341W = 0006360
+YJL148W = 0006360
+YOR340C = 0006360
+YNL248C = 0006360
+YOR210W = 0006383
+YOR210W = 0006360
+YOR210W = 0006366
+YOL005C = 0006366
+YOR151C = 0006366
+YIL021W = 0006366
+YJL140W = 0006366
+YBR154C = 0006383
+YBR154C = 0006360
+YBR154C = 0006366
+YDR404C = 0006366
+YOR224C = 0006383
+YOR224C = 0006360
+YOR224C = 0006366
+YGL070C = 0006366
+YHR143W-A = 0006383
+YHR143W-A = 0006360
+YHR143W-A = 0006366
+YDR045C = 0006383
+YJL011C = 0006384
+YJL011C = 0006384
+YNL113W = 0006383
+YNL113W = 0006360
+YKL144C = 0006383
+YNL151C = 0006383
+YNR003C = 0006383
+YKR025W = 0006383
+YPR110C = 0006383
+YPR110C = 0006360
+YDL150W = 0006383
+YPR190C = 0006383
+YNL330C = 0006348
+YNL330C = 0000183
+YNL330C = 0006347
+YNL330C = 0006312
+YNL330C = 0006325
+YNL330C = 0006325
+YNL330C = 0006342
+YNL330C = 0006355
+YNL330C = 0006355
+YNL330C = 0006476
+YNL330C = 0006476
+YJL121C = 0006098
+YHR088W = 0000027
+YKR081C = 0000027
+YKR081C = 0006364
+YBR079C = 0006413
+YBR079C = 0006413
+YER169W = 0000122
+YER169W = 0006281
+YIL119C = 0007265
+YIL119C = 0009228
+YLR075W = 0006412
+YLR075W = 0000027
+YLR075W = 0006412
+YPR102C = 0006412
+YPR102C = 0000027
+YPR102C = 0006412
+YGR085C = 0006412
+YGR085C = 0000027
+YGR085C = 0006412
+YEL054C = 0006412
+YEL054C = 0000027
+YEL054C = 0006412
+YDR418W = 0006412
+YDR418W = 0000027
+YDR418W = 0006412
+YDL082W = 0006412
+YDL082W = 0006412
+YMR142C = 0006412
+YMR142C = 0006412
+YKL006W = 0006412
+YKL006W = 0006412
+YHL001W = 0006412
+YHL001W = 0006412
+YLR029C = 0006412
+YLR029C = 0006412
+YMR121C = 0006412
+YMR121C = 0006412
+YIL133C = 0006412
+YIL133C = 0006412
+YNL069C = 0006412
+YNL069C = 0006412
+YKL180W = 0006412
+YKL180W = 0006412
+YJL177W = 0006412
+YJL177W = 0006412
+YOL120C = 0006412
+YOL120C = 0006412
+YNL301C = 0006412
+YNL301C = 0006412
+YBR084C-A = 0006412
+YBR084C-A = 0006412
+YBL027W = 0006412
+YBL027W = 0006412
+YPL220W = 0006412
+YPL220W = 0006412
+YGL135W = 0006412
+YGL135W = 0006412
+YMR242C = 0006412
+YMR242C = 0006412
+YOR312C = 0006412
+YOR312C = 0006412
+YBR191W = 0006412
+YBR191W = 0006412
+YPL079W = 0006412
+YPL079W = 0006412
+YLR061W = 0006412
+YLR061W = 0006412
+YFL034C-A = 0006412
+YFL034C-A = 0006412
+YBL087C = 0006412
+YBL087C = 0006412
+YER117W = 0006412
+YER117W = 0006412
+YGL031C = 0006412
+YGL031C = 0006412
+YGR148C = 0006412
+YGR148C = 0006412
+YOL127W = 0006412
+YOL127W = 0000027
+YOL127W = 0006412
+YLR344W = 0006412
+YLR344W = 0006412
+YGR034W = 0006412
+YGR034W = 0006412
+YHR010W = 0006412
+YHR010W = 0006412
+YDR471W = 0006412
+YDR471W = 0006412
+YGL103W = 0006412
+YGL103W = 0006412
+YFR032C-A = 0006412
+YFR032C-A = 0006412
+YFR031C-A = 0006412
+YFR031C-A = 0006412
+YIL018W = 0006412
+YIL018W = 0006412
+YOR063W = 0006412
+YOR063W = 0000027
+YOR063W = 0006412
+YGL030W = 0006412
+YGL030W = 0006364
+YGL030W = 0006371
+YGL030W = 0006412
+YGL030W = 0006445
+YDL075W = 0006412
+YDL075W = 0006412
+YLR406C = 0006412
+YLR406C = 0006412
+YBL092W = 0006412
+YBL092W = 0006412
+YPL143W = 0006412
+YPL143W = 0006412
+YOR234C = 0006412
+YOR234C = 0006412
+YER056C-A = 0006412
+YER056C-A = 0006412
+YIL052C = 0006412
+YIL052C = 0006412
+YDL191W = 0006412
+YDL191W = 0006412
+YDL136W = 0006412
+YDL136W = 0006412
+YMR194W = 0006412
+YMR194W = 0006412
+YPL249C-A = 0006412
+YPL249C-A = 0006412
+YLR185W = 0006412
+YLR185W = 0006412
+YDR500C = 0006412
+YDR500C = 0006412
+YLR325C = 0006412
+YLR325C = 0006412
+YJL189W = 0006412
+YJL189W = 0006412
+YIL148W = 0006412
+YIL148W = 0006412
+YIL148W = 0006511
+YKR094C = 0006412
+YKR094C = 0006412
+YKR094C = 0006511
+YDL184C = 0006412
+YDL184C = 0006412
+YDL133C-A = 0006412
+YDL133C-A = 0006412
+YNL162W = 0006412
+YNL162W = 0006412
+YHR141C = 0006412
+YHR141C = 0006412
+YPR043W = 0006412
+YPR043W = 0006412
+YJR094W-A = 0006412
+YJR094W-A = 0006412
+YBR031W = 0006412
+YBR031W = 0006412
+YDR012W = 0006412
+YDR012W = 0006412
+YPL131W = 0006412
+YPL131W = 0000027
+YPL131W = 0006412
+YML073C = 0006412
+YML073C = 0000027
+YML073C = 0006412
+YLR448W = 0006412
+YLR448W = 0000027
+YLR448W = 0006412
+YGL076C = 0006412
+YGL076C = 0006412
+YPL198W = 0006412
+YPL198W = 0006412
+YHL033C = 0006412
+YHL033C = 0006412
+YLL045C = 0006412
+YLL045C = 0006412
+YGL147C = 0006412
+YGL147C = 0006412
+YNL067W = 0006412
+YNL067W = 0006412
+YML091C = 0007005
+YML091C = 0001682
+YML091C = 0006412
+YHR027C = 0006511
+YHR027C = 0006511
+YHR200W = 0006511
+YHR200W = 0006511
+YFR004W = 0006511
+YFR004W = 0006511
+YFR052W = 0006511
+YLR421C = 0006508
+YLR421C = 0006508
+YGL004C = 0000004
+YIL075C = 0006511
+YIL075C = 0006511
+YER021W = 0006511
+YER021W = 0006511
+YDL020C = 0006511
+YDL020C = 0006511
+YDL147W = 0006511
+YDL147W = 0006511
+YDL097C = 0006511
+YDL097C = 0006511
+YPR108W = 0006511
+YPR108W = 0006511
+YOR261C = 0006511
+YOR261C = 0006511
+YDR427W = 0006511
+YDR427W = 0006511
+YDL140C = 0006366
+YPR187W = 0006383
+YPR187W = 0006360
+YPR187W = 0006366
+YOR116C = 0006383
+YFL036W = 0000002
+YFL036W = 0006390
+YLR340W = 0000027
+YLR340W = 0006412
+YLR340W = 0006414
+YLR340W = 0006414
+YHR062C = 0008033
+YHR062C = 0006364
+YDL081C = 0006412
+YDL081C = 0006414
+YDL081C = 0006414
+YDL130W = 0006412
+YDL130W = 0006414
+YDL130W = 0006414
+YOL039W = 0006412
+YOL039W = 0006414
+YOL039W = 0006414
+YDR382W = 0006412
+YDR382W = 0006414
+YDR382W = 0006414
+RPR1 = 0008033
+YIR015W = 0008033
+YGR214W = 0006412
+YGR214W = 0000028
+YGR214W = 0006412
+YLR048W = 0006412
+YLR048W = 0000028
+YLR048W = 0006412
+YOR293W = 0006412
+YOR293W = 0006412
+YMR230W = 0006412
+YMR230W = 0006412
+YDR025W = 0006412
+YDR025W = 0000028
+YDR025W = 0000028
+YDR025W = 0006412
+YDR025W = 0006450
+YDR025W = 0006450
+YBR048W = 0006412
+YBR048W = 0000028
+YBR048W = 0000028
+YBR048W = 0006412
+YBR048W = 0006450
+YBR048W = 0006450
+YOR369C = 0006412
+YOR369C = 0006412
+YDR064W = 0006412
+YDR064W = 0006412
+YCR031C = 0006412
+YCR031C = 0000028
+YCR031C = 0006412
+YJL191W = 0006412
+YJL191W = 0000028
+YJL191W = 0006412
+YOL040C = 0006412
+YOL040C = 0006412
+YMR143W = 0006412
+YMR143W = 0006412
+YDL083C = 0006412
+YDL083C = 0006412
+YML024W = 0006412
+YML024W = 0000028
+YML024W = 0006412
+YDR447C = 0006412
+YDR447C = 0000028
+YDR447C = 0006412
+YDR450W = 0006412
+YDR450W = 0006412
+YML026C = 0006412
+YML026C = 0006412
+YOL121C = 0006412
+YOL121C = 0006412
+YNL302C = 0006412
+YNL302C = 0006412
+YLR441C = 0006412
+YLR441C = 0006412
+YML063W = 0006412
+YML063W = 0006412
+YGL123W = 0006412
+YGL123W = 0006412
+YGL123W = 0006450
+YHL015W = 0006412
+YHL015W = 0006412
+YKR057W = 0006412
+YKR057W = 0006412
+YJL136C = 0006412
+YJL136C = 0006412
+YJL190C = 0006412
+YJL190C = 0006412
+YLR367W = 0006412
+YLR367W = 0006412
+YGR118W = 0006412
+YGR118W = 0006412
+YGR118W = 0006450
+YPR132W = 0006412
+YPR132W = 0006412
+YPR132W = 0006450
+YER074W = 0006412
+YER074W = 0006412
+YIL069C = 0006412
+YIL069C = 0006412
+YGR027C = 0006412
+YGR027C = 0006412
+YLR333C = 0006412
+YLR333C = 0006412
+YGL189C = 0006412
+YGL189C = 0006412
+YER131W = 0006412
+YER131W = 0006412
+YKL156W = 0006412
+YKL156W = 0006412
+YHR021C = 0006412
+YHR021C = 0006412
+YOR167C = 0006412
+YOR167C = 0006412
+YLR264W = 0006412
+YLR264W = 0006412
+YLR388W = 0006412
+YLR388W = 0006412
+YDL061C = 0006412
+YDL061C = 0006412
+YNL178W = 0006412
+YNL178W = 0006412
+YNL178W = 0006974
+YLR287C-A = 0006412
+YLR287C-A = 0006412
+YOR182C = 0006412
+YOR182C = 0006412
+YLR167W = 0006412
+YLR167W = 0000028
+YLR167W = 0006412
+YJR145C = 0006412
+YJR145C = 0006412
+YHR203C = 0006412
+YHR203C = 0006412
+YJR123W = 0006412
+YJR123W = 0006412
+YPL090C = 0006412
+YPL090C = 0006412
+YBR181C = 0006412
+YBR181C = 0006412
+YOR096W = 0006412
+YOR096W = 0006412
+YNL096C = 0006412
+YNL096C = 0006412
+YBL072C = 0006412
+YBL072C = 0006412
+YER102W = 0006412
+YER102W = 0006412
+YPL081W = 0006412
+YPL081W = 0006412
+YPL081W = 0006450
+YBR189W = 0006412
+YBR189W = 0006412
+YBR189W = 0006450
+YKL145W = 0006511
+YKL145W = 0006511
+YDL007W = 0006511
+YDL007W = 0006511
+YDR394W = 0006511
+YDR394W = 0006511
+YOR259C = 0006511
+YOR259C = 0006511
+YOR117W = 0006511
+YOR117W = 0006511
+YGL048C = 0006511
+YGL048C = 0006511
+YMR131C = 0007046
+YMR131C = 0007046
+YIL153W = 0006970
+YIL153W = 0006970
+YPL152W = 0006970
+YPL152W = 0006970
+YDL216C = 0000338
+YDL216C = 0000338
+YOL117W = 0000338
+YHR031C = 0006260
+YHR031C = 0006260
+YHR031C = 0006260
+YBL025W = 0006360
+YML043C = 0006360
+YKL125W = 0006360
+YLR141W = 0006360
+YBL014C = 0006360
+YJL025W = 0006360
+YMR270C = 0006360
+YDR087C = 0006364
+YPL012W = 0007046
+YPL012W = 0030490
+YHR065C = 0006365
+YHR065C = 0006371
+YHR069C = 0006365
+YHR069C = 0006402
+YOL142W = 0006365
+YOL142W = 0006402
+YDL111C = 0006365
+YDL111C = 0006402
+YCR035C = 0006365
+YCR035C = 0006402
+YDR280W = 0006365
+YDR280W = 0006402
+YGR095C = 0006365
+YGR095C = 0006402
+YMR229C = 0006364
+YMR229C = 0030490
+YOR001W = 0006365
+YCL031C = 0000028
+YCL031C = 0006365
+YDR083W = 0006364
+YDR083W = 0006364
+YPR137W = 0000154
+YPR137W = 0006365
+YPR137W = 0030490
+YOR294W = 0007046
+YOR294W = 0006364
+YPL193W = 0000027
+YLR221C = 0000004
+YOR049C = 0015908
+YGR056W = 0006338
+YLR357W = 0006338
+YDR303C = 0006355
+YDR303C = 0000074
+YDR303C = 0000074
+YHR056C = 0006355
+YKR008W = 0006338
+YLR033W = 0006338
+YCR052W = 0006338
+YCR052W = 0006338
+YFR037C = 0006338
+YFR037C = 0006338
+YML127W = 0006338
+YML127W = 0006357
+YML127W = 0009303
+YML049C = 0006371
+YML049C = 0006371
+YML049C = 0000245
+YDR041W = 0006412
+YER050C = 0006412
+YNR037C = 0006412
+YKL155C = 0006412
+YGL129C = 0006412
+YDR175C = 0006412
+YDR175C = 0009060
+YDR175C = 0009060
+YIL093C = 0006412
+YJR101W = 0006412
+YGR215W = 0006412
+YDR494W = 0000004
+YJR113C = 0006412
+YMR266W = 0000004
+YER125W = 0000209
+YER125W = 0006513
+YER125W = 0006333
+YGR152C = 0007120
+YGR152C = 0007120
+YGR152C = 0007121
+YGR152C = 0007121
+YGR152C = 0007264
+YGR152C = 0000282
+YGR213C = 0000004
+YER184C = 0000004
+YGL244W = 0006366
+YGL244W = 0006368
+YOL067C = 0008104
+YOL067C = 0008104
+YOL067C = 0006367
+YGL252C = 0007242
+YBL103C = 0006367
+YDR233C = 0000004
+YDL204W = 0000004
+YOR014W = 0006412
+YOR077W = 0000004
+YGR161C = 0000004
+YJL047C = 0000335
+YGR275W = 0000004
+YDR289C = 0000335
+YER104W = 0000335
+YNL206C = 0000335
+YHR154W = 0000335
+YLL002W = 0000335
+YDR139C = 0019942
+YOR216C = 0006888
+YOR216C = 0006888
+YDR190C = 0006357
+YPL235W = 0006357
+YPL235W = 0016074
+YPL235W = 0006365
+YCR009C = 0006897
+YCR009C = 0006970
+YCR009C = 0007121
+YDR388W = 0006897
+YDR388W = 0006970
+YDR388W = 0007121
+YPL181W = 0000004
+YBR095C = 0000747
+YBR095C = 0007125
+YDL076C = 0000004
+YKL212W = 0016311
+YKL212W = 0030384
+YDR484W = 0030029
+YDR484W = 0006896
+YDR159W = 0030029
+YDR159W = 0007067
+YDR159W = 0006611
+YDR159W = 0006611
+YDR129C = 0006897
+YDR129C = 0006970
+YDR129C = 0007121
+YDR389W = 0007264
+YDR389W = 0030037
+YFR005C = 0006371
+YGL175C = 0000706
+YHR079C-A = 0007131
+YJR004C = 0000752
+YJR004C = 0000752
+YER043C = 0006555
+YER043C = 0016259
+YLR180W = 0006555
+YDR502C = 0006555
+YPL274W = 0015805
+YPL273W = 0000096
+YDR143C = 0006325
+YER047C = 0000004
+YFR040W = 0000082
+YFR040W = 0000082
+YFR040W = 0000082
+YJL098W = 0000082
+YJL098W = 0000082
+YJL098W = 0000082
+YKR028W = 0000082
+YKR028W = 0000082
+YKR028W = 0000082
+YMR263W = 0006348
+YMR263W = 0000183
+YMR263W = 0006347
+YGL229C = 0000082
+YGL229C = 0000082
+YPL218W = 0006888
+YDL153C = 0006325
+YDL153C = 0006325
+YDL153C = 0030490
+YDL153C = 0030490
+YMR127C = 0006348
+YBL052C = 0006347
+YBL052C = 0006348
+YBL052C = 0016568
+YDR181C = 0006348
+YOR213C = 0006348
+YCR008W = 0030003
+YCR008W = 0030003
+YKL117W = 0006457
+YKL117W = 0006457
+YKL117W = 0006457
+YDR351W = 0007117
+YHR103W = 0007117
+YER087C-B = 0006613
+YER019C-A = 0006613
+YHL034C = 0016070
+YDR180W = 0007064
+YER147C = 0007062
+YOR329C = 0009306
+YOR329C = 0009306
+YPR129W = 0000004
+Q0160 = 0006314
+YHR205W = 0008361
+YHR205W = 0007574
+YHR205W = 0006468
+YHR205W = 0006468
+YMR214W = 0006457
+YGL011C = 0006511
+YGL011C = 0006511
+YDL139C = 0000004
+YGR049W = 0007049
+YBR037C = 0006461
+YBR037C = 0006825
+YBR037C = 0006825
+YBR024W = 0006825
+YOR367W = 0000004
+YJL080C = 0007059
+YJL080C = 0008298
+SCR1 = 0045047
+YER120W = 0006020
+YGL126W = 0006644
+YMR272C = 0006631
+YBL011W = 0008654
+YBL011W = 0008654
+YMR305C = 0000747
+YGL028C = 0007109
+YGR279C = 0000747
+YGL083W = 0000004
+YGR245C = 0030036
+YGR245C = 0007089
+YDR469W = 0006348
+YDR469W = 0016571
+YLL016W = 0007265
+YKL148C = 0006105
+YKL148C = 0006121
+YKL148C = 0006099
+YLL041C = 0006105
+YLL041C = 0006121
+YLL041C = 0006099
+YKL141W = 0006105
+YKL141W = 0006121
+YKL141W = 0006099
+YDR178W = 0006105
+YDR178W = 0006121
+YDR178W = 0006099
+YIL168W = 0009069
+YIL113W = 0000196
+YIL113W = 0000196
+YKL193C = 0006605
+YKL193C = 0006605
+YKL193C = 0006605
+YKL193C = 0007059
+YKL193C = 0007059
+YGL056C = 0000004
+YBR214W = 0006259
+YBR214W = 0007126
+YBR214W = 0006897
+YIL084C = 0016440
+YIL084C = 0016440
+YIL084C = 0016575
+YIL084C = 0016575
+YGL224C = 0006206
+YDR164C = 0006887
+YDR164C = 0006887
+YDR164C = 0006904
+YDR164C = 0006906
+YLR166C = 0016288
+YLR166C = 0006893
+YLR166C = 0006904
+YLR166C = 0006906
+YLR166C = 0007121
+YLR166C = 0000283
+YIR022W = 0006465
+YIR022W = 0006465
+YIR022W = 0006465
+YIR022W = 0006465
+YIR022W = 0006465
+YNR026C = 0006888
+YLR208W = 0006902
+YLR208W = 0006888
+YMR079W = 0006893
+YMR079W = 0015914
+YGL233W = 0016288
+YGL233W = 0006893
+YGL233W = 0006904
+YGL233W = 0006906
+YGL233W = 0007121
+YGL233W = 0000283
+YPL085W = 0006914
+YPL085W = 0016192
+YBL050W = 0006888
+YBL050W = 0006888
+YBL050W = 0006888
+YBR080C = 0000011
+YBR080C = 0006888
+YNL272C = 0006887
+YDR498C = 0006890
+YDR498C = 0006906
+YNL287W = 0006888
+YNL287W = 0006890
+YLR268W = 0006888
+YLR268W = 0006890
+YLR268W = 0006891
+YLR268W = 0006906
+YPR181C = 0006888
+YPR181C = 0006888
+YPR181C = 0006914
+YIL109C = 0006888
+YIL109C = 0006914
+YDR238C = 0006888
+YGL137W = 0006888
+YGL137W = 0006890
+YIL076W = 0006901
+YIL076W = 0006901
+YIL076W = 0006888
+YER008C = 0016288
+YER008C = 0006893
+YER008C = 0006904
+YER008C = 0006906
+YER008C = 0007121
+YER008C = 0000283
+YDL195W = 0006888
+YFL005W = 0016288
+YFL005W = 0006893
+YFL005W = 0006906
+YFL005W = 0007121
+YFL005W = 0007264
+YDR166C = 0016288
+YDR166C = 0006893
+YDR166C = 0006904
+YDR166C = 0006906
+YDR166C = 0007121
+YDR166C = 0000283
+YFL045C = 0045047
+YMR013C = 0045047
+YMR013C = 0006486
+YIL068C = 0016288
+YIL068C = 0006893
+YIL068C = 0006904
+YIL068C = 0006906
+YIL068C = 0007121
+YIL068C = 0000283
+YIL068C = 0006897
+YLR378C = 0006616
+YPL094C = 0006616
+YOR254C = 0006616
+YML105C = 0006617
+YBR171W = 0006616
+YDR170C = 0006888
+YDR170C = 0006891
+YLR292C = 0006616
+YPR055W = 0016288
+YPR055W = 0006893
+YPR055W = 0006904
+YPR055W = 0006906
+YPR055W = 0007121
+YPR055W = 0000283
+YGR009C = 0006893
+YGR009C = 0006906
+YDR077W = 0007047
+YDR077W = 0007047
+YCR067C = 0006888
+YCR067C = 0006888
+YLR026C = 0006888
+YLR026C = 0006890
+YLR026C = 0006891
+YLR026C = 0006906
+YBL066C = 0000004
+YGL100W = 0006406
+YGL100W = 0006407
+YGL100W = 0006408
+YGL100W = 0006409
+YGL100W = 0006607
+YGL100W = 0006608
+YGL100W = 0006609
+YGL100W = 0006610
+YGL100W = 0006611
+YGL100W = 0006999
+YML013W = 0000004
+YDR363W-A = 0030447
+YDR363W-A = 0006887
+YDR363W-A = 0006887
+YDR363W-A = 0000074
+YLR430W = 0006364
+YMR059W = 0006388
+YLR105C = 0006388
+YAR008W = 0006388
+YPL083C = 0006388
+YAL067C = 0006810
+YOR184W = 0009070
+YOR184W = 0006564
+YOR184W = 0006564
+YOR184W = 0009113
+YGR208W = 0009070
+YER081W = 0006564
+YIL074C = 0006564
+YDR023W = 0006418
+YHR119W = 0016571
+YHR119W = 0016571
+YHR119W = 0006348
+YJL168C = 0016571
+YJL168C = 0016571
+YJL168C = 0006355
+YJL168C = 0006355
+YKR029C = 0016575
+YKR029C = 0016575
+YKR029C = 0045835
+YJL105W = 0000004
+YHR207C = 0000004
+YPL165C = 0000004
+YOR165W = 0016044
+YDL168W = 0019649
+YNL049C = 0006888
+YHR098C = 0006888
+YHR098C = 0006888
+YJR095W = 0015741
+YJR095W = 0015744
+YLR321C = 0006338
+YLR321C = 0006338
+YJL145W = 0015914
+YLL003W = 0000086
+YOR140W = 0000122
+YOR140W = 0000122
+YLR403W = 0008361
+YKL006C-A = 0006891
+YKL006C-A = 0006891
+YKL006C-A = 0006891
+YBL102W = 0006895
+YBL102W = 0006895
+YIL099W = 0007151
+YLR336C = 0018987
+YLR336C = 0018987
+YLR336C = 0018987
+YLR336C = 0018987
+YPR198W = 0015893
+YPR198W = 0042493
+YCL010C = 0016573
+YGL066W = 0016573
+YDR346C = 0000004
+YJR134C = 0000004
+YIR001C = 0016071
+YMR190C = 0045132
+YMR190C = 0000070
+YMR190C = 0006268
+YMR190C = 0007001
+YOR057W = 0000074
+YOR057W = 0000069
+YOR057W = 0006461
+YOR057W = 0006461
+YOR057W = 0016567
+YOR057W = 0019933
+YOR057W = 0019933
+YOR007C = 0000004
+YPR161C = 0006350
+YPR161C = 0006350
+YPR161C = 0006350
+YPR161C = 0006468
+YPR161C = 0006468
+YER096W = 0006031
+YER096W = 0030437
+YBL031W = 0000004
+YGL228W = 0000004
+YKL130C = 0008298
+YBR130C = 0008298
+YOR035C = 0008298
+YDR393W = 0007005
+YBR258C = 0016571
+YBR263W = 0006730
+YLR058C = 0006730
+YER118C = 0007124
+YER118C = 0007232
+YBL058W = 0005977
+YBL058W = 0007151
+YIL104C = 0016074
+YIL104C = 0016074
+YDL212W = 0006888
+YDL212W = 0006888
+YDL212W = 0006865
+YOL110W = 0006500
+YOL110W = 0007265
+YOL110W = 0008104
+YDL225W = 0000902
+YDL225W = 0000902
+YDL225W = 0000902
+YDL225W = 0016288
+YDL225W = 0016288
+YDL225W = 0016288
+YDL225W = 0000283
+YDL225W = 0000283
+YDL225W = 0000283
+YHL006C = 0000004
+YDR078C = 0000004
+YGR112W = 0007585
+YGR112W = 0007585
+YOR137C = 0015992
+YLR079W = 0000079
+YLR079W = 0000079
+YLR079W = 0000079
+YLR079W = 0000079
+YLR079W = 0000082
+YBR103W = 0045835
+YBR103W = 0000122
+YBR103W = 0006348
+YBR103W = 0006348
+YBR103W = 0016575
+YBR103W = 0016575
+YLR197W = 0000154
+YLR197W = 0006365
+YLR197W = 0030490
+YIL123W = 0000226
+YOL004W = 0006357
+YOL004W = 0006348
+YOL004W = 0000183
+YOL004W = 0006347
+YOL004W = 0006357
+YNL236W = 0006366
+YDR422C = 0006350
+YDR422C = 0006468
+YDR422C = 0007165
+YMR175W = 0006970
+YGL208W = 0006350
+YGL208W = 0006468
+YGL208W = 0007165
+YNL257C = 0006367
+YJL089W = 0006357
+YJL089W = 0006357
+YJL089W = 0045722
+YJL089W = 0045722
+YMR140W = 0042149
+YMR140W = 0042149
+YKR101W = 0006343
+YKR101W = 0006347
+YDL042C = 0006303
+YDL042C = 0006333
+YDL042C = 0006348
+YDL042C = 0007574
+YDL042C = 0006347
+YDL042C = 0006348
+YLR442C = 0006303
+YLR442C = 0007574
+YLR442C = 0006342
+YDR227W = 0006303
+YDR227W = 0007574
+YDR227W = 0006342
+YNL007C = 0006413
+YKR072C = 0009651
+YKR072C = 0009651
+YKR072C = 0007346
+YEL065W = 0015892
+YEL065W = 0006879
+YEL065W = 0006879
+YDL047W = 0000082
+YDL047W = 0007243
+YDL047W = 0006468
+YDL047W = 0007047
+YDL047W = 0030036
+YNL032W = 0006470
+YNL032W = 0006950
+YDR409W = 0016927
+YDR409W = 0016927
+YLR398C = 0006402
+YLR398C = 0006445
+YLR398C = 0006445
+YLR398C = 0006445
+YLR398C = 0006445
+YLR398C = 0006402
+YPR189W = 0006402
+YPR189W = 0006402
+YGR195W = 0006402
+YGR195W = 0006365
+YGR195W = 0006402
+YOR076C = 0006402
+YGL213C = 0006402
+YGL213C = 0006402
+YOL113W = 0006468
+YOL113W = 0000074
+YGR143W = 0007047
+YGR143W = 0006078
+YGR143W = 0006078
+YHR206W = 0006979
+YHR206W = 0006970
+YHR206W = 0006350
+YHR206W = 0006350
+YNL167C = 0000122
+YDR328C = 0006511
+YDR328C = 0000082
+YDR328C = 0000086
+YPL026C = 0006468
+YPL026C = 0015758
+YPL026C = 0045944
+YBL061C = 0016288
+YBL061C = 0006038
+YBL061C = 0006970
+YMR216C = 0042307
+YMR216C = 0006376
+YMR216C = 0006873
+YMR216C = 0042493
+YBL007C = 0000147
+YBL007C = 0007015
+YBL007C = 0007015
+YBL007C = 0007047
+YBL007C = 0007121
+YNL243W = 0006887
+YNL243W = 0006897
+YNL243W = 0007015
+YNL243W = 0007047
+YNL243W = 0007121
+YDL052C = 0030148
+YKL108W = 0006271
+YKL108W = 0006271
+YGL113W = 0006268
+YGL113W = 0006270
+YGL113W = 0006270
+YDR515W = 0006878
+YDR515W = 0006878
+YDR515W = 0006445
+YDR515W = 0006445
+YDR515W = 0006445
+YOR008C = 0006970
+YOR008C = 0007047
+YOR008C = 0007266
+YOR008C = 0007266
+YOR008C = 0007266
+YOR008C = 0000283
+YOR008C = 0009408
+YOR008C = 0009408
+YOR008C = 0030036
+YGR271W = 0006445
+YGR271W = 0006445
+YGR271W = 0006445
+YGR271W = 0006445
+YBR156C = 0007059
+YBR156C = 0006468
+YBR156C = 0006468
+YOR195W = 0007126
+YOR195W = 0000071
+YOR195W = 0000071
+YIL147C = 0006468
+YIL147C = 0007234
+YLR139C = 0009060
+YLR139C = 0006412
+YHR030C = 0006468
+YHR030C = 0007165
+YDR088C = 0006371
+YBR228W = 0006281
+YLR135W = 0006260
+YER116C = 0006310
+YER116C = 0006310
+YDR189W = 0006888
+YOR307C = 0006888
+YNL196C = 0000004
+YPL027W = 0007152
+YML066C = 0007152
+YER029C = 0006371
+YER029C = 0006371
+YFL008W = 0000070
+YFR031C = 0007076
+YFR031C = 0007076
+YFR031C = 0007076
+YFR031C = 0000070
+YJL074C = 0007064
+YJL074C = 0007130
+YJL074C = 0007151
+YLR086W = 0007076
+YLR086W = 0007076
+YLR086W = 0000070
+YOL034W = 0006281
+YOL034W = 0008283
+YGR074W = 0006371
+YGR074W = 0006371
+YLR275W = 0006371
+YLR147C = 0006371
+YLR147C = 0006371
+YOR159C = 0006371
+YOL122C = 0006828
+YHR050W = 0006828
+YHR050W = 0006828
+YLR034C = 0006880
+YGR229C = 0006075
+YGR229C = 0007047
+YPR054W = 0006468
+YPR054W = 0007152
+YML058W = 0006974
+YML058W = 0007005
+YNR015W = 0006400
+YBR182C = 0006350
+YMR165C = 0009060
+YMR165C = 0006276
+YOR149C = 0006276
+YDR510W = 0016927
+YFL017W-A = 0006371
+YPR182W = 0006371
+YKL079W = 0006887
+YBR172C = 0007010
+YDR525W-A = 0000004
+YJL151C = 0000004
+YDL123W = 0000004
+YAL030W = 0006893
+YAL030W = 0006897
+YAL030W = 0006906
+YOR327C = 0006893
+YOR327C = 0006897
+YOR327C = 0006906
+YDR477W = 0006995
+YDR477W = 0006468
+YDR477W = 0006006
+YDR477W = 0007165
+YDR073W = 0006338
+YNR023W = 0006338
+YOR290C = 0006338
+YDL194W = 0007165
+YDL194W = 0009749
+YGL115W = 0006357
+YGL115W = 0007031
+YBR289W = 0006338
+YHL025W = 0006338
+YLR025W = 0045324
+YPL002C = 0045014
+YPL002C = 0006623
+YPL002C = 0006623
+YGR197C = 0042493
+YIL016W = 0006999
+YDR478W = 0006364
+YMR095C = 0009228
+YMR095C = 0008614
+YMR095C = 0008614
+YMR095C = 0008614
+YNL334C = 0009228
+YNL334C = 0008614
+YNL334C = 0008614
+YNL334C = 0008614
+YFL060C = 0009228
+YFL060C = 0008614
+YFL060C = 0008614
+YFL060C = 0008614
+YMR322C = 0000004
+YIL061C = 0006371
+YDR011W = 0000304
+YDR011W = 0042493
+snR10 = 0000154
+snR10 = 0006365
+snR11 = 0000154
+snR11 = 0006365
+snR128 = 0000154
+snR128 = 0000154
+snR13 = 0000154
+snR14 = 0006371
+snR17a = 0000154
+snR17a = 0006364
+snR17a = 0006364
+snR17b = 0000154
+snR17b = 0006364
+snR17b = 0006364
+snR18 = 0000154
+snR189 = 0000154
+snR19 = 0006371
+snR190 = 0000154
+snR24 = 0000154
+snR3 = 0000154
+snR30 = 0006365
+snR30 = 0006364
+snR31 = 0000154
+snR32 = 0000154
+snR33 = 0000154
+snR34 = 0000154
+snR35 = 0000154
+snR36 = 0000154
+snR37 = 0000154
+snR38 = 0000154
+snR38 = 0000154
+snR39 = 0000154
+snR39 = 0000154
+snR39B = 0000154
+snR4 = 0000154
+snR40 = 0000154
+snR41 = 0000154
+snR42 = 0000154
+snR43 = 0000154
+snR44 = 0000154
+snR45 = 0000154
+snR46 = 0000154
+snR47 = 0000154
+snR48 = 0000154
+snR49 = 0000154
+snR5 = 0000154
+snR50 = 0000154
+snR51 = 0000154
+snR52 = 0000154
+snR53 = 0000154
+snR54 = 0000154
+snR55 = 0000154
+snR56 = 0000154
+snR57 = 0000154
+snR58 = 0000154
+snR59 = 0000154
+snR6 = 0006371
+snR6 = 0006371
+snR60 = 0000154
+snR61 = 0000154
+snR62 = 0000154
+snR63 = 0000154
+snR64 = 0000154
+snR65 = 0000154
+snR66 = 0000154
+snR67 = 0000154
+snR68 = 0000154
+snR69 = 0000154
+snR7-L = 0006371
+snR7-L = 0006372
+snR7-S = 0006371
+snR7-S = 0006372
+snR70 = 0000154
+snR71 = 0000154
+snR72 = 0000154
+snR73 = 0000154
+snR74 = 0000154
+snR75 = 0000154
+snR76 = 0000154
+snR77 = 0000154
+snR78 = 0000154
+snR79 = 0000154
+snR8 = 0000154
+snR9 = 0000154
+YCR033W = 0016575
+YCR033W = 0016575
+YCR033W = 0045835
+YGL131C = 0000004
+YPR101W = 0006371
+YPR101W = 0006371
+YKL173W = 0006371
+YEL026W = 0006371
+YEL026W = 0030490
+YDL098C = 0006371
+YDR240C = 0006371
+YOR308C = 0006371
+YGR013W = 0006371
+YJL036W = 0006914
+YJL036W = 0006810
+YDR425W = 0000004
+YMR096W = 0009228
+YMR096W = 0008614
+YMR096W = 0008614
+YMR096W = 0008614
+YNL333W = 0009228
+YNL333W = 0008614
+YNL333W = 0008614
+YNL333W = 0008614
+YFL059W = 0009228
+YFL059W = 0008614
+YFL059W = 0008614
+YFL059W = 0008614
+YJR104C = 0006801
+YJR104C = 0006878
+YHR008C = 0006800
+tE(UUC)G1 = 0006414
+YLL011W = 0000154
+YLL011W = 0006365
+YLL011W = 0030490
+YOR353C = 0000004
+YGL127C = 0006366
+YGL127C = 0006281
+YDR006C = 0019933
+YMR016C = 0007124
+YMR016C = 0007124
+YNR034W = 0008033
+YNR034W = 0008033
+YCR073W-A = 0008033
+YCR073W-A = 0008033
+YHR163W = 0008033
+YHR163W = 0008033
+YGR248W = 0000004
+YEL059C-A = 0006508
+YEL059C-A = 0006508
+YEL059C-A = 0006508
+YEL059C-A = 0006508
+YEL059C-A = 0006508
+YJR159W = 0006000
+YJR159W = 0006013
+YDL246C = 0000004
+YMR066W = 0000004
+YLL021W = 0007015
+YLL021W = 0007121
+YLL021W = 0007124
+YLL021W = 0007266
+YLL021W = 0000283
+YLL021W = 0000283
+YLL021W = 0007050
+YCL054W = 0006364
+YFL002C = 0000027
+YFL002C = 0006365
+YJR010C-A = 0006465
+YJR010C-A = 0006465
+YJR010C-A = 0006465
+YJR010C-A = 0006465
+YJR010C-A = 0006465
+YGL093W = 0007020
+YDR356W = 0007020
+YDR201W = 0007020
+YDR201W = 0000071
+YML055W = 0006465
+YML055W = 0006465
+YML055W = 0006465
+YML055W = 0006465
+YML055W = 0006465
+YMR117C = 0007020
+YMR117C = 0007059
+YMR117C = 0007059
+YER018C = 0007020
+YER018C = 0007059
+YER018C = 0007059
+YPL124W = 0007020
+YPL124W = 0007103
+YLR066W = 0006465
+YLR066W = 0006465
+YLR066W = 0006465
+YLR066W = 0006465
+YLR066W = 0006465
+YLR066W = 0006465
+YLR066W = 0006465
+YKR037C = 0007020
+YKR037C = 0000071
+YKL042W = 0007020
+YKL042W = 0007103
+YAL047C = 0000022
+YAL047C = 0000065
+YAL047C = 0007020
+YHR172W = 0007020
+YNL126W = 0007020
+YNL126W = 0000071
+YKL184W = 0015940
+YOL052C = 0015940
+YPR069C = 0015940
+YPR069C = 0008295
+YLR146C = 0015940
+YLR146C = 0006597
+YEL031W = 0006486
+YEL031W = 0006874
+YGR236C = 0000004
+YLR313C = 0007015
+YLR313C = 0007121
+YLR313C = 0007124
+YLR313C = 0007266
+YLR313C = 0000283
+YLR313C = 0000283
+YER150W = 0000004
+YHR136C = 0007049
+YNL012W = 0007126
+YHL022C = 0042138
+YHR152W = 0007127
+YHR152W = 0000278
+YHR152W = 0000278
+YHR152W = 0007096
+YHR014W = 0045876
+YHR014W = 0045876
+YKR031C = 0007126
+YKR031C = 0030437
+YHR153C = 0007151
+YPL130W = 0007126
+YMR017W = 0006906
+YMR017W = 0007152
+YOL091W = 0007152
+YOL091W = 0007126
+YIL073C = 0007126
+YPR007C = 0007062
+YAL009W = 0006997
+YAL009W = 0006997
+YAL009W = 0007126
+YAL009W = 0007151
+YDR104C = 0007152
+YDR104C = 0007152
+YER046W = 0007151
+YGL170C = 0007151
+YLL005C = 0007151
+YLR341W = 0007151
+YPL138C = 0006348
+YPL138C = 0006355
+YPL138C = 0016571
+YOR148C = 0006371
+YBR152W = 0006371
+YDR464W = 0000122
+YOR190W = 0007151
+YDR218C = 0000902
+YDR218C = 0007047
+YGR059W = 0000902
+YGR059W = 0007047
+YGR059W = 0007152
+YGR059W = 0000753
+YER115C = 0030437
+YDR523C = 0007151
+YDR523C = 0006468
+YHR139C = 0007152
+YNL204C = 0030435
+YNL202W = 0007151
+YNL202W = 0007151
+YNL202W = 0009062
+YNL202W = 0009062
+YDR522C = 0007151
+YOR313C = 0007151
+YOR313C = 0006259
+YOR313C = 0007126
+YJL127C = 0006338
+YJL127C = 0006358
+YPL175W = 0006506
+YER148W = 0006360
+YER148W = 0006367
+YER148W = 0006367
+YER148W = 0006367
+YER148W = 0006384
+YGL207W = 0006338
+YGL207W = 0006358
+YGL207W = 0006368
+YER161C = 0000122
+YOL148C = 0016568
+YOL148C = 0016573
+YMR179W = 0006350
+YMR179W = 0006357
+YKL020C = 0009409
+YKL020C = 0009409
+YKL020C = 0045944
+YKL020C = 0006631
+YDR392W = 0000747
+YDR392W = 0016568
+YDR392W = 0016573
+YDR392W = 0030437
+YDR392W = 0030447
+YDR392W = 0007125
+YGR063C = 0006325
+YGR063C = 0006355
+YGR063C = 0006355
+YGR063C = 0006368
+YML010W = 0006325
+YML010W = 0006355
+YML010W = 0006355
+YML010W = 0006355
+YML010W = 0006368
+YGR116W = 0006325
+YGR116W = 0006355
+YGR116W = 0006334
+YGR116W = 0006368
+YBR081C = 0016568
+YBR081C = 0016573
+YLR055C = 0016568
+YLR055C = 0016573
+YIR012W = 0000027
+YIR012W = 0000027
+YHR041C = 0006366
+YER022W = 0006366
+YGR104C = 0006366
+YBR253W = 0006366
+YDR308C = 0006366
+YCR081W = 0000122
+YML034W = 0016359
+YCR018C = 0006364
+YEL025C = 0000004
+YOR247W = 0006139
+YLR082C = 0006139
+YKR091W = 0006139
+YGL097W = 0006407
+YGL097W = 0000054
+YLR119W = 0006612
+YLR119W = 0006612
+YLR119W = 0006623
+YLR119W = 0006623
+YPR032W = 0016194
+YBL106C = 0016194
+YCL037C = 0006412
+YNL189W = 0006913
+YDR292C = 0045047
+YKL154W = 0045047
+YDL092W = 0045047
+YKL122C = 0045047
+YKR092C = 0006913
+YPR088C = 0045047
+YPL243W = 0045047
+YPL210C = 0045047
+YMR101C = 0006486
+YMR101C = 0006486
+YNL138W = 0007010
+YNL138W = 0007265
+YKL218C = 0000004
+YAL005C = 0000060
+YAL005C = 0006457
+YAL005C = 0006616
+YLL024C = 0006457
+YLL024C = 0006616
+YBL075C = 0006457
+YBL075C = 0006616
+YBL075C = 0006950
+YER103W = 0006616
+YER103W = 0006950
+YER103W = 0006950
+YER103W = 0006457
+YDL229W = 0006412
+YNL209W = 0006412
+YJR045C = 0006457
+YJR045C = 0006628
+YDR293C = 0007049
+YPL106C = 0006457
+YBR169C = 0006457
+YHR066W = 0000747
+YHR066W = 0000027
+YDR312W = 0000747
+YDR312W = 0000027
+YBR283C = 0006613
+YKL124W = 0000004
+YLR006C = 0007234
+YNR031C = 0000168
+YNR031C = 0006468
+YNR031C = 0007231
+YCR073C = 0000168
+YCR073C = 0006468
+YCR073C = 0007231
+YLR005W = 0006289
+YLR005W = 0006367
+YLR005W = 0006367
+YLR005W = 0007070
+YLR005W = 0000717
+YIL143C = 0006367
+YIL143C = 0006367
+YIL143C = 0007070
+YIL143C = 0000717
+YIL030C = 0006378
+YDR443C = 0000122
+YPL042C = 0000122
+YPL042C = 0006468
+YNL025C = 0000122
+YPL232W = 0006893
+YPL232W = 0006906
+YMR183C = 0006893
+YMR183C = 0006906
+YHR184W = 0007152
+YHR184W = 0007152
+YHR184W = 0006461
+YLR250W = 0009306
+YOR242C = 0007152
+YLR369W = 0006261
+YLR369W = 0006880
+YDR086C = 0006613
+YLR452C = 0007165
+YLR452C = 0000754
+YLR452C = 0000754
+YPL092W = 0000316
+YNL222W = 0006367
+YNL222W = 0006367
+YDR160W = 0007606
+YDR160W = 0007606
+YJL156C = 0007606
+YJL156C = 0007606
+YHR064C = 0006412
+YHR064C = 0006412
+YHR064C = 0006412
+YHR064C = 0006412
+MAL5 = 0005975
+YNL309W = 0000082
+YNL309W = 0000082
+YMR053C = 0016575
+YDR169C = 0000004
+YMR019W = 0000004
+YHR178W = 0009410
+YKL072W = 0000004
+YOR047C = 0007165
+YOR047C = 0006006
+YOR047C = 0009651
+YOR047C = 0006357
+YOR047C = 0006357
+YLR362W = 0006468
+YLR362W = 0007124
+YLR362W = 0000750
+YHR084W = 0007124
+YHR084W = 0007125
+YHR084W = 0007329
+YHR084W = 0000747
+YOR219C = 0007323
+YOR219C = 0007323
+YDR410C = 0007323
+YJR086W = 0000750
+YFL026W = 0000749
+YHL007C = 0007124
+YHL007C = 0000750
+YHL007C = 0000282
+YHL007C = 0006468
+YLR389C = 0006508
+YLR389C = 0007323
+YJR117W = 0007323
+YKL178C = 0000750
+YKL178C = 0000750
+YOR212W = 0000750
+YOR212W = 0000750
+YOR212W = 0000750
+YDR103W = 0000750
+YDR103W = 0000750
+YCL032W = 0000750
+YCL032W = 0000750
+YCL032W = 0000190
+YCL032W = 0000190
+YCL032W = 0000161
+YCL032W = 0000161
+YKL209C = 0000770
+YDL159W = 0006468
+YDL159W = 0007124
+YDL159W = 0000750
+YDL130W-A = 0015986
+YGR008C = 0015986
+YIL126W = 0006338
+YIL126W = 0007126
+YOR027W = 0006457
+YOR027W = 0006457
+YDR536W = 0006810
+YLR150W = 0006916
+YDR082W = 0016233
+YMR125W = 0006371
+YDR463W = 0006388
+YDR463W = 0045944
+YDR463W = 0045944
+YDR463W = 0045944
+YHR006W = 0045944
+YHR006W = 0045944
+YHR006W = 0045944
+YCL008C = 0006612
+YCL008C = 0006612
+YCL008C = 0006623
+YCL008C = 0006623
+YLR375W = 0000004
+YDL048C = 0000004
+YJR130C = 0006790
+YGL184C = 0009086
+YIR011C = 0006511
+YIR011C = 0006511
+YIR011C = 0007059
+YGL022W = 0006487
+YGL022W = 0006486
+YLR305C = 0006646
+YLR305C = 0030036
+YLR305C = 0009306
+YBL034C = 0007020
+YLR045C = 0007020
+YLR045C = 0000071
+YMR054W = 0007035
+YMR054W = 0007035
+YGL169W = 0008151
+YPR086W = 0006367
+YPR086W = 0006367
+YPR086W = 0006367
+YPR086W = 0006367
+YPR086W = 0006367
+YMR039C = 0006369
+YMR039C = 0045944
+YMR039C = 0045944
+YMR039C = 0045944
+YDL084W = 0006372
+YDL084W = 0006406
+YDL084W = 0006406
+YDL084W = 0006406
+YDL084W = 0006406
+YDL084W = 0006406
+YIL162W = 0005987
+tG(UCC)O = 0006414
+tP(AGG)N = 0006414
+tP(UGG)O2 = 0006414
+tG(GCC)C = 0006414
+tG(GCC)O2 = 0006414
+tP(AGG)C = 0006414
+tG(GCC)F1 = 0006414
+tG(CCC)D = 0006414
+tG(UCC)G = 0006414
+tG(CCC)O = 0006414
+tG(UCC)N = 0006414
+tP(UGG)M = 0006414
+tP(UGG)H = 0006414
+tP(UGG)F = 0006414
+YNL244C = 0006413
+YJR007W = 0006413
+YPL237W = 0006413
+YBR294W = 0008272
+YBR294W = 0008272
+YLR092W = 0008272
+YDR310C = 0006347
+YDR310C = 0006348
+YDR310C = 0007088
+YDR310C = 0007088
+YNL066W = 0007005
+tY(GUA)F1 = 0006414
+SUQ5 = 0006412
+tS(UGA)I = 0006414
+tS(UGA)E = 0006414
+tY(GUA)D = 0006414
+SUP30 = 0000004
+tY(GUA)O = 0006414
+YDR172W = 0006415
+tY(GUA)J2 = 0006414
+YBR143C = 0006415
+YBR143C = 0006415
+tY(GUA)M1 = 0006414
+tL(UAA)J = 0006414
+tL(CAA)C = 0006414
+tL(CAA)G2 = 0006414
+tL(CAA)A = 0006414
+tY(GUA)F2 = 0006414
+tS(CGA)C = 0006414
+tY(GUA)J1 = 0006414
+SUP166 = 0000004
+tY(GUA)M2 = 0006414
+YPL057C = 0006675
+YDR297W = 0006665
+YDR297W = 0006665
+YLR372W = 0006633
+YLR372W = 0006892
+YLR372W = 0030148
+YLR372W = 0030497
+YML052W = 0007151
+YGL162W = 0006357
+YGL162W = 0006357
+YGL162W = 0015918
+YPR009W = 0015918
+YPR009W = 0006357
+YPR009W = 0006357
+YPL029W = 0006396
+YPL029W = 0006396
+YPL032C = 0006897
+YPL163C = 0042221
+YDR320C = 0007029
+YAL011W = 0000004
+YAR003W = 0006348
+YAR003W = 0016571
+YKL018W = 0016571
+YBR175W = 0006348
+YBR175W = 0016571
+YJL187C = 0000086
+YJL187C = 0000086
+YJL187C = 0000086
+YJL187C = 0000079
+YJL187C = 0000078
+YJL187C = 0040020
+YJL187C = 0040020
+YJL187C = 0040020
+YDR126W = 0000004
+YOR333C = 0000004
+YAR042W = 0000004
+YPL016W = 0006338
+YJL176C = 0006338
+YER111C = 0007049
+YDR146C = 0000114
+YLR182W = 0006350
+YLR182W = 0007126
+YLR182W = 0007126
+YLR182W = 0000083
+YDR260C = 0007152
+YMR149W = 0006487
+YDR334W = 0000004
+YDR395W = 0006913
+YDR395W = 0006406
+YDR416W = 0007049
+YDR416W = 0006371
+YDR416W = 0006371
+YGR129W = 0007049
+YGR129W = 0006371
+YIL047C = 0007165
+YLR251W = 0000004
+YAL014C = 0000004
+NP_009388 = 0000004
+YCR030C = 0000004
+YJL004C = 0006895
+YJL004C = 0016050
+YPR095C = 0045045
+YGL243W = 0006400
+YJL035C = 0006400
+YLR316C = 0006400
+YGR274C = 0000114
+YGR274C = 0000114
+YGR274C = 0006367
+YGR274C = 0006367
+YGR274C = 0006367
+YGR274C = 0006468
+YDR167W = 0000114
+YDR167W = 0000114
+YDR167W = 0006325
+YDR167W = 0006367
+YDR167W = 0006367
+YDR167W = 0006367
+YDR167W = 0006473
+YDR167W = 0016568
+YDR167W = 0016573
+YML015C = 0000114
+YML015C = 0000114
+YML015C = 0006367
+YML015C = 0006367
+YML015C = 0006367
+YDR145W = 0000114
+YDR145W = 0000114
+YDR145W = 0006325
+YDR145W = 0006367
+YDR145W = 0006367
+YDR145W = 0006367
+YDR145W = 0006473
+YDR145W = 0016568
+YDR145W = 0016573
+YML098W = 0000114
+YML098W = 0000114
+YML098W = 0006367
+YML098W = 0006367
+YML098W = 0006367
+YPL129W = 0000114
+YPL129W = 0000114
+YPL129W = 0006338
+YPL129W = 0006367
+YPL129W = 0006367
+YCR042C = 0000114
+YCR042C = 0006367
+YCR042C = 0006367
+YCR042C = 0006367
+YPL011C = 0000114
+YPL011C = 0000114
+YPL011C = 0006367
+YPL011C = 0006367
+YPL011C = 0006367
+YMR005W = 0006366
+YBR198C = 0000114
+YBR198C = 0006325
+YBR198C = 0006367
+YBR198C = 0006367
+YBR198C = 0006367
+YBR198C = 0006473
+YBR198C = 0016568
+YBR198C = 0016573
+YGL112C = 0000114
+YGL112C = 0000114
+YGL112C = 0006325
+YGL112C = 0006367
+YGL112C = 0006367
+YGL112C = 0006367
+YGL112C = 0006473
+YGL112C = 0016568
+YGL112C = 0016573
+YMR227C = 0000114
+YMR227C = 0000114
+YMR227C = 0006367
+YMR227C = 0006367
+YMR227C = 0006367
+YML114C = 0006366
+YMR236W = 0000114
+YMR236W = 0000114
+YMR236W = 0006325
+YMR236W = 0006367
+YMR236W = 0006367
+YMR236W = 0006367
+YMR236W = 0006473
+YMR236W = 0016568
+YMR236W = 0016573
+YJR046W = 0030174
+YPR048W = 0000004
+YLR354C = 0006098
+YLR354C = 0006098
+YIL129C = 0000902
+YIL129C = 0000902
+YIL129C = 0007114
+YIL129C = 0007114
+YMR028W = 0007165
+YMR028W = 0008151
+YLR154W-A = 0000004
+YBR069C = 0006865
+YOL020W = 0015801
+YPL128C = 0006345
+YBR150C = 0000004
+YDR161W = 0000004
+YDR350C = 0000004
+YBR044C = 0006461
+YBR044C = 0006461
+YDR212W = 0006457
+YDR212W = 0007010
+YJL052W = 0006094
+YJL052W = 0006096
+YJR009C = 0006094
+YJR009C = 0006096
+YGR192C = 0006094
+YGR192C = 0006096
+YBR223C = 0006281
+YOR337W = 0006350
+YOR337W = 0006350
+YBR083W = 0007124
+YBR083W = 0007124
+YBR083W = 0045944
+YPR080W = 0006414
+YBR118W = 0006414
+YKL081W = 0006414
+YBL088C = 0006974
+YBL088C = 0007004
+YGR099W = 0007004
+YML064C = 0007165
+YML064C = 0000087
+YLR010C = 0016233
+YNL128W = 0007152
+YJR019C = 0019395
+YJR019C = 0019395
+YKL028W = 0006367
+YKL028W = 0006367
+YKR062W = 0006367
+YKR062W = 0006367
+YDR311W = 0006289
+YDR311W = 0006367
+YDR311W = 0006367
+YDR311W = 0007070
+YDR311W = 0000717
+YPL122C = 0006289
+YPL122C = 0006367
+YPL122C = 0006367
+YPL122C = 0007070
+YPL122C = 0000717
+YDR460W = 0006289
+YDR460W = 0006367
+YDR460W = 0006367
+YDR460W = 0007070
+YDR460W = 0000717
+YPR056W = 0006367
+YPR056W = 0006367
+YPR056W = 0007070
+YBR123C = 0006384
+YAL001C = 0006384
+YGR047C = 0006384
+YDR362C = 0006384
+YOR110W = 0006384
+YPL007C = 0006384
+YGR186W = 0006367
+YGR186W = 0006367
+YGR005C = 0006367
+YGR005C = 0006367
+YDL185W = 0006314
+YDL185W = 0007035
+YDL185W = 0007035
+YDL185W = 0019538
+YPL234C = 0007035
+YPL234C = 0007035
+YLR178C = 0030162
+YLR178C = 0030162
+YKL140W = 0006629
+YDR058C = 0006629
+YPL157W = 0006387
+YJR156C = 0009228
+YNL332W = 0009228
+YDL244W = 0009228
+YBR240C = 0009228
+YOL055C = 0009228
+YOL055C = 0009228
+YPL258C = 0009228
+YPL258C = 0009228
+YPR121W = 0009228
+YPR121W = 0009228
+YDL080C = 0009228
+YGR144W = 0006281
+YGR144W = 0009228
+YFL058W = 0009228
+YPL214C = 0009228
+YLR237W = 0015888
+YOR143C = 0009228
+YER063W = 0006351
+YOL072W = 0006310
+YOL072W = 0000282
+YOL072W = 0006368
+YHR167W = 0006368
+YHR025W = 0009092
+YHR025W = 0006566
+YHR025W = 0006555
+YHR025W = 0006549
+YCR053W = 0006566
+YIL078W = 0006412
+YIL144W = 0007020
+YIL144W = 0007059
+YIL144W = 0007059
+YKR059W = 0006413
+YMR260C = 0006413
+YJL138C = 0006413
+YJL138C = 0006446
+YPR163C = 0006413
+YMR146C = 0006413
+YDR429C = 0006413
+YGR162W = 0006413
+YGL049C = 0006413
+YPR041W = 0006446
+YPR041W = 0006446
+YPR041W = 0042256
+YPR016C = 0042273
+YPR016C = 0030489
+YDR322C-A = 0015986
+YDR322C-A = 0015986
+YDR322C-A = 0015986
+YDR322C-A = 0015986
+YGR181W = 0006628
+YGR181W = 0006628
+YGR181W = 0006628
+YJL143W = 0006628
+YOR297C = 0006612
+YOR297C = 0006612
+YOR297C = 0006626
+YOR297C = 0006626
+YDL217C = 0006628
+YIL022W = 0006628
+YPL063W = 0030150
+YPL063W = 0030150
+YJL054W = 0006628
+YJL054W = 0006628
+YJR135W-A = 0006628
+YJR135W-A = 0006628
+YJR135W-A = 0006628
+YJR135W-A = 0006628
+YEL020W-A = 0006628
+YEL020W-A = 0006628
+YEL020W-A = 0006628
+YEL020W-A = 0006628
+YBR067C = 0007047
+YGL145W = 0006890
+YPR040W = 0007165
+YPR040W = 0007165
+YER011W = 0006950
+YER011W = 0007047
+YOR010C = 0006950
+YIL011W = 0000004
+YOR009W = 0000004
+YLR136C = 0000004
+YPR074C = 0006098
+YPR074C = 0006098
+YBR117C = 0006098
+TLC1 = 0007004
+YDR468C = 0006906
+YOL018C = 0006906
+YER175C = 0000004
+YGR260W = 0015890
+YGR260W = 0015890
+YOR194C = 0006367
+YKL058W = 0006367
+YNL273W = 0006265
+YKR010C = 0006265
+YJL093C = 0030007
+YJL093C = 0030007
+YDR457W = 0000209
+YDR457W = 0006513
+YDR457W = 0006913
+YDR457W = 0006997
+YDR457W = 0007067
+YGR082W = 0006628
+YNL131W = 0006628
+YNL131W = 0006628
+YMR060C = 0006628
+YMR060C = 0006628
+YMR060C = 0006628
+YMR203W = 0006628
+YPR133W-A = 0006628
+YPR133W-A = 0006628
+YOR045W = 0006628
+YNL070W = 0006628
+YNL121C = 0006628
+YHR117W = 0000004
+YOL006C = 0000020
+YOL006C = 0006265
+YOL006C = 0006265
+YOL006C = 0006271
+YOL006C = 0006333
+YOL006C = 0006357
+YOL006C = 0006368
+YOL006C = 0007076
+YOL006C = 0007076
+YOL006C = 0007097
+YOL006C = 0007097
+YNL088W = 0000020
+YNL088W = 0006265
+YNL088W = 0006271
+YNL088W = 0006333
+YNL088W = 0007131
+YLR234W = 0000018
+YLR234W = 0007004
+YLR234W = 0007131
+YLR234W = 0007131
+YJR066W = 0007046
+YJR066W = 0007126
+YJR066W = 0007165
+YJR066W = 0000074
+YJR066W = 0000080
+YKL203C = 0007010
+YKL203C = 0007046
+YKL203C = 0007165
+YKL203C = 0007266
+YKL203C = 0000074
+YKL203C = 0000080
+YKL203C = 0030037
+YBR162C = 0000004
+YGR221C = 0000004
+YLR183C = 0000004
+YGL096W = 0000004
+YGR096W = 0006810
+YAL016W = 0006412
+YAL016W = 0007015
+YAL016W = 0007094
+YAL016W = 0007117
+YDR050C = 0006094
+YDR050C = 0006096
+YJL164C = 0007124
+YJL164C = 0006468
+YJL164C = 0007265
+YPL203W = 0006468
+YPL203W = 0007124
+YPL203W = 0007265
+YKL166C = 0006468
+YKL166C = 0007124
+YNL079C = 0000011
+YNL079C = 0016192
+YNL079C = 0000001
+YNL079C = 0006887
+YNL079C = 0007015
+YNL079C = 0007118
+YNL079C = 0007118
+YNL079C = 0007118
+YNL079C = 0007119
+YNL079C = 0007119
+YNL079C = 0007119
+YNL079C = 0008154
+YNL079C = 0008154
+YNL079C = 0008154
+YNL079C = 0008298
+YNL079C = 0000283
+YNL079C = 0000283
+YNL079C = 0000283
+YIL138C = 0000011
+YIL138C = 0016192
+YIL138C = 0000001
+YIL138C = 0006887
+YIL138C = 0007015
+YIL138C = 0007118
+YIL138C = 0007118
+YIL138C = 0007118
+YIL138C = 0007119
+YIL138C = 0007119
+YIL138C = 0007119
+YIL138C = 0008154
+YIL138C = 0008154
+YIL138C = 0008154
+YIL138C = 0008298
+YIL138C = 0000283
+YIL138C = 0000283
+YIL138C = 0000283
+YLL028W = 0015846
+YGR138C = 0015846
+YPR156C = 0015846
+YOR273C = 0015846
+YMR156C = 0000004
+YBR126C = 0005975
+YBR126C = 0005975
+YBR126C = 0006950
+YBR126C = 0006950
+YBR126C = 0006950
+YDR074W = 0005975
+YDR074W = 0006950
+YMR261C = 0006950
+YMR261C = 0005992
+YMR261C = 0005992
+YMR261C = 0005992
+YOL102C = 0006388
+YHR099W = 0016573
+YHR099W = 0016573
+YHR099W = 0016573
+YHR099W = 0006357
+YOL115W = 0006265
+YOL115W = 0006265
+YOL115W = 0007062
+YOL115W = 0007076
+YOL115W = 0007076
+YNL299W = 0007062
+YNL299W = 0007062
+YMR233W = 0000004
+YJL129C = 0030007
+YKR050W = 0030007
+YJL087C = 0006388
+YJL087C = 0006388
+YJL087C = 0006989
+YDR120C = 0030488
+YOL093W = 0000004
+YKR056W = 0006400
+YDL112W = 0030488
+YHR070W = 0030488
+YHR070W = 0030488
+YHR070W = 0030488
+YBR061C = 0030488
+YBR061C = 0006412
+YDL201W = 0030488
+YDR165W = 0030488
+tP(UGG)A = 0006414
+YDR007W = 0006520
+YDR007W = 0000162
+YER090W = 0000162
+YER090W = 0000162
+YKL211C = 0000162
+YDR354W = 0000162
+YDR354W = 0000162
+YGL026C = 0000162
+YGL026C = 0000162
+YDR353W = 0030503
+YDR353W = 0030503
+YDR353W = 0030503
+YHR106W = 0006979
+tR(CCG)L = 0006414
+YDR407C = 0006888
+YMR218C = 0006888
+YBR254C = 0006888
+YDR246W = 0006888
+YDR472W = 0006888
+YOR115C = 0006888
+tT(CGU)K = 0006414
+YLR043C = 0000011
+YLR043C = 0000011
+YLR043C = 0006261
+YLR043C = 0006261
+YLR043C = 0006979
+YLR043C = 0042144
+YLR043C = 0030503
+YGR209C = 0000011
+YGR209C = 0000011
+YGR209C = 0006261
+YGR209C = 0006261
+YGR209C = 0006979
+YGR209C = 0042144
+YGR209C = 0030503
+YCR083W = 0006979
+YML028W = 0006979
+YML028W = 0006979
+YML028W = 0030503
+YML028W = 0030503
+YML028W = 0030503
+YDR453C = 0030503
+YDR453C = 0030503
+YBR265W = 0030148
+YBR265W = 0030148
+YBR265W = 0030148
+YBR265W = 0006666
+YER093C = 0030148
+YDL015C = 0000038
+YDL015C = 0000038
+YDL015C = 0000038
+YBR058C-A = 0006666
+YBR058C-A = 0030148
+YML100W = 0006950
+YML100W = 0005992
+YML100W = 0005992
+YML100W = 0005992
+YDL060W = 0042254
+YLR435W = 0000004
+YDR513W = 0006979
+YDR513W = 0030503
+YDR513W = 0030503
+YML085C = 0007061
+YML085C = 0000070
+YML085C = 0000743
+YML085C = 0000065
+YML085C = 0000065
+YML085C = 0000743
+YML085C = 0007061
+YML085C = 0000070
+YFL037W = 0007061
+YFL037W = 0000070
+YFL037W = 0000743
+YFL037W = 0000065
+YFL037W = 0000065
+YFL037W = 0000743
+YFL037W = 0007061
+YFL037W = 0000070
+YML124C = 0007061
+YML124C = 0000070
+YML124C = 0000743
+YML124C = 0000065
+YML124C = 0000065
+YML124C = 0000743
+YML124C = 0007061
+YML124C = 0000070
+YLR212C = 0007020
+YLR212C = 0000071
+YOR187W = 0006414
+YKL034W = 0000004
+YCR084C = 0006350
+YCR084C = 0016481
+YCR084C = 0016481
+YCR084C = 0016481
+YLR425W = 0007165
+YLR425W = 0007165
+YLR425W = 0007047
+YLR425W = 0007047
+YGR080W = 0007121
+YGR080W = 0008154
+YGR080W = 0008154
+YOR344C = 0045821
+YOR344C = 0045821
+YBR166C = 0006570
+YGR185C = 0006418
+YGR185C = 0006418
+YGR185C = 0006437
+YOR295W = 0006360
+YOR295W = 0006360
+YKL210W = 0006512
+YDR390C = 0016927
+YDR390C = 0016927
+YPR066W = 0006512
+YPR066W = 0019943
+YHR111W = 0006464
+YDR177W = 0000209
+YDR177W = 0006513
+YDR177W = 0006897
+YDR177W = 0007153
+YOR339C = 0000209
+YOR339C = 0006513
+YLR306W = 0000209
+YLR306W = 0006513
+YLR306W = 0019943
+YDR092W = 0000209
+YDR092W = 0006301
+YDR092W = 0006301
+YDR092W = 0006513
+YBR082C = 0000209
+YBR082C = 0006513
+YBR082C = 0006950
+YBR082C = 0007151
+YDR059C = 0000209
+YDR059C = 0006513
+YDR059C = 0006897
+YDR059C = 0006950
+YDR059C = 0006986
+YDR059C = 0007151
+YER100W = 0000209
+YER100W = 0006513
+YEL012W = 0000209
+YEL012W = 0006513
+YDL064W = 0008054
+YDL064W = 0000086
+YLL039C = 0000209
+YLL039C = 0006513
+YLL039C = 0016579
+YLL039C = 0006950
+YLL039C = 0007151
+YDL122W = 0016579
+YNL186W = 0016579
+YKR098C = 0000004
+YJL197W = 0000004
+YBL067C = 0000004
+YBR058C = 0016579
+YMR304W = 0016579
+YPL072W = 0016579
+YOR124C = 0016579
+YER151C = 0016579
+YER144C = 0016579
+YFR010W = 0016579
+YIL156W = 0016579
+YMR223W = 0016579
+YER098W = 0016579
+YGR184C = 0000209
+YGR184C = 0006513
+YLR024C = 0000209
+YLR024C = 0006513
+YBR165W = 0016567
+YBR165W = 0006611
+YGR048W = 0006397
+YGR048W = 0015031
+YDL190C = 0006511
+YDL190C = 0006511
+YDL190C = 0006511
+YDL190C = 0006950
+YKL010C = 0000209
+YKL010C = 0006513
+YOR075W = 0006890
+YOR075W = 0006906
+YML088W = 0006974
+YML088W = 0006511
+YGR019W = 0019740
+YBR006W = 0006538
+YBR006W = 0006538
+YBR006W = 0006538
+YBR006W = 0006979
+YBR006W = 0006979
+YBR006W = 0006979
+YDL170W = 0006357
+YDL170W = 0019740
+YDL210W = 0006810
+YDR470C = 0008053
+YDR470C = 0008053
+YDR470C = 0006810
+YKL035W = 0006486
+YKL035W = 0006011
+YLR189C = 0016125
+YDL169C = 0000004
+YAR027W = 0000004
+YPL186C = 0000004
+YKR044W = 0000004
+YPL003W = 0019943
+YPL020C = 0000086
+YPL020C = 0016928
+YPL020C = 0016928
+YIL031W = 0016928
+YIL031W = 0016928
+YIL031W = 0007094
+YIL031W = 0007094
+YIL031W = 0006276
+YIL031W = 0006276
+YPL139C = 0040020
+YDR207C = 0042061
+YDR207C = 0007068
+YBR173C = 0030163
+YML021C = 0006281
+YDR213W = 0008202
+YDR213W = 0016126
+YGR072W = 0006402
+YGR072W = 0000184
+YKL216W = 0019856
+YMR271C = 0019856
+YJL130C = 0019856
+YEL021W = 0019856
+YLR420W = 0006221
+YML106W = 0019856
+YKL024C = 0006139
+YBL039C = 0019856
+YBL039C = 0008654
+YJR103W = 0019856
+YJR103W = 0008654
+YNL229C = 0006808
+YNL229C = 0006808
+YNL229C = 0006808
+YDR400W = 0008655
+YNR012W = 0008655
+YNR012W = 0008655
+YIL008W = 0006464
+YML029W = 0000004
+YGL098W = 0000004
+YDL058W = 0006461
+YDL058W = 0006888
+YKR042W = 0007005
+YJL109C = 0030490
+YJL109C = 0030490
+YKL099C = 0030490
+YKL099C = 0030490
+YLR222C = 0030490
+YLR222C = 0030490
+YML093W = 0030490
+YML093W = 0030490
+YMR093W = 0030490
+YMR093W = 0030490
+YJL069C = 0000004
+YPR144C = 0000004
+YBL004W = 0000004
+YLR409C = 0000004
+YGR090W = 0000004
+YKR060W = 0000004
+YDR324C = 0030490
+YDR324C = 0030490
+YDR398W = 0030490
+YDR398W = 0030490
+YDR449C = 0030490
+YDR449C = 0030490
+YER082C = 0030490
+YER082C = 0030490
+YGR128C = 0030490
+YGR128C = 0030490
+YHR196W = 0030490
+YHR196W = 0030490
+YJR049C = 0019675
+YJR049C = 0006879
+YEL040W = 0007047
+YEL038W = 0000004
+YEL035C = 0000004
+YEL005C = 0000004
+YLR386W = 0006644
+YLR386W = 0006644
+YLR386W = 0000011
+YNL054W = 0006644
+YNL054W = 0006644
+YNL054W = 0000011
+YEL013W = 0000011
+YEL013W = 0006623
+YEL013W = 0042145
+YEL013W = 0042145
+YOR068C = 0000004
+YOR106W = 0006896
+YOR106W = 0006906
+YDL077C = 0042145
+YDL077C = 0042145
+YDL077C = 0007033
+YGL212W = 0006896
+YGL212W = 0006906
+YML115C = 0006487
+YML115C = 0006487
+Q0140 = 0000028
+Q0140 = 0006412
+Q0140 = 0006412
+YGR094W = 0006438
+YDL128W = 0006816
+YDL128W = 0006816
+YDL128W = 0006874
+YGL258W = 0000004
+YGR065C = 0015878
+YDR359C = 0000004
+YLR373C = 0007039
+YBR105C = 0016192
+YNL212W = 0000004
+YIL017C = 0000004
+YGL227W = 0006808
+YPL253C = 0007017
+YPL253C = 0007017
+YLR410W = 0030036
+YHR039C-A = 0007035
+YHR039C-A = 0007035
+YHR039C-A = 0005977
+YPR036W = 0007035
+YPR036W = 0007035
+YBR127C = 0007035
+YBR127C = 0007035
+YGR105W = 0006461
+YGR105W = 0006461
+YHR060W = 0006461
+YHR060W = 0007035
+YHR060W = 0005977
+YOR332W = 0007035
+YOR332W = 0007035
+YKL080W = 0007035
+YKL080W = 0007035
+YLR447C = 0007034
+YLR447C = 0007034
+YLR447C = 0007035
+YLR447C = 0007035
+YGR020C = 0007035
+YGR020C = 0007035
+YEL051W = 0007035
+YEL051W = 0007035
+YOR270C = 0006797
+YOR270C = 0007035
+YOR270C = 0007035
+YKL119C = 0006461
+YKL119C = 0007035
+YKR001C = 0006623
+YKR001C = 0007034
+YKR001C = 0045053
+YLL040C = 0045324
+YLL040C = 0045324
+YLL040C = 0045053
+YBR097W = 0006623
+YBR097W = 0007034
+YBR097W = 0045053
+YPL045W = 0006623
+YPL045W = 0007033
+YPL045W = 0042145
+YPL045W = 0006895
+YPL045W = 0045324
+YOR132W = 0042147
+YMR077C = 0045324
+YOR089C = 0006897
+YOR089C = 0006623
+YKL041W = 0045324
+YJR102C = 0045014
+YJR102C = 0006623
+YJR102C = 0006623
+YNR006W = 0045053
+YPL065W = 0006612
+YPL065W = 0006612
+YPL065W = 0006623
+YPL065W = 0006623
+YHR012W = 0042147
+YDR495C = 0006623
+YPL120W = 0006623
+YPL120W = 0006623
+YPL120W = 0006914
+YLR396C = 0042145
+YLR396C = 0006895
+YLR396C = 0045324
+YLR240W = 0000011
+YLR240W = 0006468
+YLR240W = 0006623
+YLR240W = 0007034
+YJL154C = 0045053
+YJL154C = 0042147
+YLR417W = 0045053
+YLR417W = 0045014
+YLR417W = 0006623
+YLR417W = 0006623
+YLR360W = 0045324
+YLR360W = 0045324
+YPR173C = 0045053
+YPR173C = 0045324
+YPR173C = 0045324
+YDR080W = 0042145
+YDR080W = 0042145
+YDR080W = 0007033
+YGL095C = 0006896
+YGL095C = 0007033
+YGL095C = 0006461
+YOR069W = 0045053
+YOR069W = 0042147
+YJL029C = 0006896
+YJR044C = 0045324
+YDR486C = 0000004
+YDR136C = 0006623
+YGR141W = 0006623
+YLR261C = 0006623
+YDR200C = 0006623
+YLR322W = 0006623
+YPR139C = 0006623
+YKR020W = 0006623
+YKR020W = 0007118
+YOL129W = 0006623
+YPR087W = 0006623
+YJR126C = 0006623
+YML041C = 0006623
+YDR485C = 0006623
+YGL104C = 0006623
+YDR372C = 0006623
+YNL246W = 0006623
+YAL002W = 0045324
+YAL002W = 0045324
+YML097C = 0006623
+YGL225W = 0015780
+YGL225W = 0015780
+YGL225W = 0006487
+YGL225W = 0030259
+YLR337C = 0006897
+YLR337C = 0006970
+YLR337C = 0007015
+YLR337C = 0007121
+YLR181C = 0000004
+YER072W = 0042144
+YFL004W = 0008104
+YFL004W = 0042144
+YFL004W = 0042144
+YPL019C = 0042144
+YJL012C = 0042144
+YIL173W = 0006896
+YJL222W = 0006896
+YMR197C = 0006891
+YMR197C = 0006896
+YMR197C = 0006906
+YMR197C = 0008333
+YOR359W = 0006623
+YML076C = 0000004
+YEL002C = 0006487
+YEL002C = 0007049
+YOR043W = 0006950
+YOR043W = 0040008
+YNL197C = 0008361
+YNL197C = 0008361
+YDL224C = 0008361
+YOR083W = 0008361
+YOL097C = 0006436
+YNL283C = 0007047
+YNL283C = 0007047
+YNL283C = 0007266
+YNL283C = 0007266
+YNL283C = 0009408
+YNL283C = 0009408
+YNL283C = 0030036
+YOL105C = 0007047
+YOL105C = 0007266
+YOL105C = 0007266
+YOL105C = 0009408
+YOL105C = 0009408
+YOL105C = 0030036
+YHL028W = 0007047
+YHL028W = 0007266
+YHL028W = 0007266
+YHL028W = 0009408
+YHL028W = 0009408
+YHL028W = 0030036
+YHR134W = 0016927
+YOR230W = 0040020
+YOR229W = 0040020
+YFL010C = 0000004
+YIL101C = 0006950
+YIL101C = 0006950
+YLR090W = 0000004
+YGR194C = 0005998
+YJR133W = 0006164
+YDR369C = 0042138
+YDR369C = 0000727
+YLR070C = 0005996
+YJR067C = 0000004
+YNL107W = 0006342
+YPL252C = 0006784
+YPL252C = 0006784
+YJL141C = 0006468
+YJL141C = 0008151
+YJL141C = 0008151
+YML007W = 0006979
+YML007W = 0042493
+YHR161C = 0006897
+YHR161C = 0006897
+YGR241C = 0006897
+YGR241C = 0006897
+YHL009C = 0006357
+YIR018W = 0045944
+YDR259C = 0045944
+YOL028C = 0045944
+YPL239W = 0000004
+YAR035W = 0009437
+YAR035W = 0006066
+YER024W = 0009437
+YER024W = 0006066
+YER024W = 0006066
+YLL048C = 0015721
+YDR135C = 0015691
+YDR135C = 0015723
+YDR135C = 0015723
+YDR135C = 0015700
+YDR325W = 0007076
+YDR325W = 0007076
+YHR135C = 0006468
+YHR135C = 0006468
+YHR135C = 0007165
+YNL154C = 0006468
+YNL154C = 0006468
+YNL154C = 0007165
+YER123W = 0006468
+YCR004C = 0000004
+YLR272C = 0000070
+YLR272C = 0007076
+YLR272C = 0007076
+YPL087W = 0006672
+YPL087W = 0009408
+YNL064C = 0006626
+YEL004W = 0015788
+YEL004W = 0006038
+YLR249W = 0006414
+YER041W = 0000004
+YKL065C = 0000004
+YDL120W = 0006879
+YDL120W = 0006879
+YDL120W = 0006879
+YDL120W = 0006879
+YDL120W = 0006879
+YDL120W = 0018283
+YDL120W = 0018283
+YOL128C = 0006468
+YOL128C = 0006468
+YOL128C = 0006508
+YNL160W = 0006950
+YNL160W = 0007584
+YGR234W = 0006950
+YGR234W = 0006950
+YLR298C = 0006371
+YJL059W = 0006885
+YDL198C = 0006810
+YDL198C = 0000002
+YMR241W = 0006842
+YDR451C = 0000122
+YDR451C = 0000122
+YDR451C = 0040020
+YDR451C = 0040020
+YNL263C = 0006888
+YCR059C = 0006521
+YCR059C = 0006521
+YMR152W = 0006627
+YMR151W = 0000004
+YGR172C = 0016192
+YNL044W = 0006888
+YGL198W = 0000004
+YGL161C = 0000004
+YKL095W = 0000004
+YKL094W = 0000004
+YLR200W = 0006457
+YLR200W = 0006457
+YLR200W = 0007021
+YLR200W = 0007021
+YKL196C = 0006891
+YKL196C = 0006906
+YKL199C = 0000004
+YMR284W = 0006281
+YMR284W = 0006303
+YMR284W = 0000723
+YMR284W = 0000724
+YMR284W = 0006333
+YMR106C = 0006281
+YMR106C = 0006303
+YMR106C = 0000723
+YMR106C = 0000724
+YMR106C = 0006333
+YHL014C = 0000004
+YPR058W = 0006810
+YBR104W = 0006810
+YML038C = 0015780
+YPR024W = 0007005
+YFR049W = 0006412
+YER005W = 0006486
+YOR064C = 0016573
+YOR064C = 0016568
+YOR064C = 0016568
+YOR064C = 0016568
+YHR090C = 0016568
+YHR090C = 0016568
+YHR090C = 0016568
+YKL067W = 0000004
+YPR028W = 0016044
+YPR028W = 0016044
+YGR281W = 0006810
+YGR281W = 0042493
+YDR057W = 0006888
+YML027W = 0000004
+YBR183W = 0006672
+YDL235C = 0007234
+YDL235C = 0007234
+YDL235C = 0006970
+YKL126W = 0006468
+YKL126W = 0006468
+YKL126W = 0006665
+YKL126W = 0006897
+YMR104C = 0006468
+YDR368W = 0019566
+YLR120C = 0016485
+YLR121C = 0019538
+YLR121C = 0019538
+YGL259W = 0000004
+YIR039C = 0000004
+YDR349C = 0000004
+YFL038C = 0006888
+YFL038C = 0006461
+YBR264C = 0007030
+YNL304W = 0000001
+YER031C = 0016192
+YER031C = 0016192
+YER031C = 0006887
+YGL210W = 0016192
+YGL210W = 0016192
+YGL210W = 0006887
+YHR105W = 0000004
+YKR014C = 0006897
+YKR014C = 0006623
+YNL093W = 0006897
+YNL093W = 0006623
+YLR262C = 0006886
+YLR262C = 0006886
+YLR262C = 0042147
+YLR262C = 0042147
+YML001W = 0000011
+YML001W = 0016192
+YML001W = 0006896
+YDR381W = 0016973
+YKL214C = 0016973
+YDR002W = 0006606
+YDR002W = 0006405
+YDR002W = 0006511
+YDR002W = 0000082
+YIL063C = 0006406
+YIL063C = 0006407
+YIL063C = 0006408
+YIL063C = 0006409
+YIL063C = 0006607
+YIL063C = 0006608
+YIL063C = 0006609
+YIL063C = 0006610
+YIL063C = 0006611
+YIL063C = 0006611
+YIL063C = 0006999
+YDR545W = 0000004
+YER190W = 0000004
+YGR296W = 0000004
+YLR466W = 0000004
+YLR467W = 0000004
+YNL339C = 0000004
+YPL283C = 0000004
+YBR054W = 0000004
+YOR162C = 0045944
+YOR162C = 0006855
+YOR162C = 0006855
+YBR111C = 0000004
+YHR017W = 0000004
+YHR016C = 0007015
+YHR016C = 0006897
+YFR024C = 0000004
+YLR277C = 0006379
+YLR277C = 0006379
+YLR277C = 0006378
+YLR277C = 0006378
+YNR065C = 0000004
+YOR003W = 0030163
+YKR053C = 0030148
+YBR148W = 0000004
+YBR162W-A = 0009306
+YMR089C = 0006461
+YMR089C = 0006508
+YMR089C = 0045041
+YPL074W = 0000004
+YGR270W = 0030163
+YPR107C = 0006378
+YPR107C = 0006378
+YPR107C = 0006379
+YPR107C = 0006379
+YPR107C = 0006378
+YPR107C = 0006379
+YOR272W = 0007001
+YOR272W = 0042273
+YOR272W = 0042273
+YNL237W = 0000004
+YJR099W = 0016579
+YJL139C = 0000032
+YJL139C = 0006487
+YOR087W = 0030003
+YOR087W = 0030003
+YOR087W = 0030003
+YOR087W = 0030003
+YIR026C = 0007126
+YIR026C = 0007151
+YJL056C = 0006357
+YJL056C = 0006882
+YMR273C = 0000283
+YMR273C = 0006342
+YML109W = 0000183
+YML109W = 0007574
+YML109W = 0000283
+YDR285W = 0007126
+YDR285W = 0007129
+YGL249W = 0007130
+YJR127C = 0000004
+YGR211W = 0000074
+YOL154W = 0000004
+YMR243C = 0006749
+YMR243C = 0006824
+YMR243C = 0006829
+YMR243C = 0006882
+YNR039C = 0006829
+YER033C = 0000004
+YGL255W = 0006830
+YLR130C = 0006831
+YLR130C = 0006831
+YKL175W = 0006829
+YKL175W = 0006829
+YKL175W = 0006882
+YBR046C = 0000004
+YGR285C = 0006457
+YNL241C = 0006098
+YAL035C-A = 0000004
+YAL043C-A = 0000004
+YAL058C-A = 0000004
+mTPx = 0030503
+mTPx = 0030503
+YCR062W = 0000004
+YCR097WA = 0000004
+YDR210W-C = 0006319
+YDR210W-D = 0006319
+TOS9 = 0000004
+FRDS = 0008152
+YEL076W-C = 0000004
+YFL013W-A = 0000004
+YFL043C = 0000004
+TOS3 = 0000004
+TOS10 = 0000004
+HSN1 = 0000004
+YIL015C-A = 0000004
+SDH1b = 0045333
+SFH1 = 0000004
+MLP1 = 0000004
+TOS5 = 0000004
+GIN11 = 0000004
+MSF1 = 0000004
+YML010C-B = 0000004
+YML010W-A = 0000004
+YML013C-A = 0000004
+YML035C-A = 0000004
+YML048W-A = 0000004
+YML058C-A = 0000004
+YML095C-A = 0000004
+YML100W-A = 0000004
+YML102C-A = 0000004
+YML117W-A = 0000004
+HUF = 0008152
+HUF = 0008152
+TOS6 = 0000004
+CPD1 = 0000304
+TOS7 = 0000004
+SLS1 = 0006616
+SLS1 = 0006616
+TOS11 = 0000004
+YOR343C-A = 0006319
+YOR343C-B = 0006319
diff --git a/geworkbench-core/classes/.svn/text-base/cellcomp.anno.svn-base b/geworkbench-core/classes/.svn/text-base/cellcomp.anno.svn-base
new file mode 100644
index 0000000..a9259ae
--- /dev/null
+++ b/geworkbench-core/classes/.svn/text-base/cellcomp.anno.svn-base
@@ -0,0 +1,5745 @@
+(species=Saccharomyces cerevisiae) (type=Cellular Component) (curator=GO)
+YMR056C = 0005743
+YBR085W = 0005743
+YJR155W = 0008372
+YNL331C = 0008372
+YOL165C = 0008372
+YCR107W = 0008372
+YDL243C = 0008372
+YFL056C = 0008372
+YNL141W = 0005622
+Q0080 = 0000276
+YHR047C = 0008372
+YBL074C = 0008372
+YKL106W = 0005739
+YLR027C = 0005737
+YLR027C = 0005777
+YGL119W = 0008372
+YBR236C = 0008372
+YKL112W = 0005717
+YMR072W = 0000262
+YJR108W = 0008372
+YCR088W = 0005856
+YCR088W = 0005737
+YOR239W = 0005884
+YOR239W = 0005884
+YNR033W = 0008372
+YER045C = 0005634
+YGR037C = 0008372
+YNR016C = 0005829
+YNR016C = 0005789
+YLR131C = 0005634
+YLR131C = 0005829
+YLR144C = 0005622
+YJR083C = 0008372
+YBL015W = 0005829
+YDR511W = 0005758
+YLR304C = 0005829
+YLR304C = 0005759
+YKL192C = 0005829
+YAL054C = 0005829
+YLR153C = 0005829
+YFL039C = 0005884
+YFL039C = 0000141
+YFL039C = 0000142
+YFL039C = 0005857
+YFL039C = 0000123
+YDR448W = 0000124
+YAR015W = 0008372
+YNL220W = 0008372
+YLR359W = 0008372
+YLR028C = 0005829
+YMR120C = 0005829
+YOR128C = 0008372
+YGR204W = 0005737
+YMR300C = 0008372
+YGL234W = 0005737
+YGR061C = 0008372
+YDR408C = 0008372
+YOL086C = 0005829
+YMR303C = 0005737
+YMR083W = 0005759
+YGL256W = 0008372
+YBR145W = 0008372
+YMR318C = 0005625
+YCR105W = 0005625
+YDR226W = 0005737
+YDR226W = 0005758
+YER170W = 0005743
+YJR105W = 0008372
+YCR011C = 0016021
+YCR011C = 0005737
+YCR011C = 0005783
+YDR216W = 0005634
+YDR216W = 0005634
+YDR216W = 0005634
+YCR010C = 0016020
+YDL239C = 0005819
+YDL239C = 0005628
+YDL239C = 0005628
+YLR227C = 0008372
+YMR064W = 0008372
+YMR282C = 0005739
+YEL052W = 0008372
+YLR397C = 0005622
+YER017C = 0005743
+YDR085C = 0005936
+YPL202C = 0005634
+YPL202C = 0005634
+YNR044W = 0005618
+YNR044W = 0005618
+YGL032C = 0005618
+YDR524C = 0008372
+YIL044C = 0008372
+YCL025C = 0005886
+YBR132C = 0005774
+YBR132C = 0005789
+YBR132C = 0005887
+YFL055W = 0005886
+YDR214W = 0008372
+YOR023C = 0005671
+YLR109W = 0005737
+YHR093W = 0008372
+Q0050 = 0005739
+Q0055 = 0005739
+Q0060 = 0005739
+Q0065 = 0005739
+Q0070 = 0005739
+Q0075 = 0005739
+YMR092C = 0005857
+YMR092C = 0005737
+YMR092C = 0005634
+YIL079C = 0005634
+YDL175C = 0005634
+YBR059C = 0008372
+YDR264C = 0016020
+YOR034C = 0008372
+YOR335C = 0005737
+YMR170C = 0005737
+YMR170C = 0005737
+YMR169C = 0005737
+YOR374W = 0005739
+YOR374W = 0005739
+YER073W = 0005739
+YPL061W = 0005737
+YPL061W = 0005737
+YNL148C = 0005874
+YNL148C = 0005737
+YNL148C = 0005634
+YBR110W = 0008372
+YNL048W = 0016020
+YNL048W = 0005783
+YGL065C = 0005783
+YPL227C = 0005789
+YOR002W = 0005783
+YBR243C = 0005783
+YOR067C = 0005789
+YOR067C = 0005789
+YNL219C = 0005783
+YNL219C = 0005783
+YGL021W = 0008372
+YML086C = 0005739
+YNL270C = 0005886
+YOL130W = 0005886
+YFL050C = 0005886
+YGR225W = 0005680
+YML035C = 0008372
+YDR242W = 0008372
+YBR158W = 0008372
+YGL156W = 0005774
+YJR047C = 0005840
+YEL036C = 0000137
+YEL036C = 0000136
+YPR128C = 0005779
+YPR128C = 0005737
+YBR231C = 0008372
+YPR180W = 0008372
+YCL050C = 0008372
+YDR530C = 0008372
+YNL172W = 0005680
+YDL008W = 0005680
+YLR127C = 0005680
+YDR118W = 0005680
+YOR249C = 0005680
+YLR102C = 0005680
+YBR151W = 0008372
+YKL157W = 0005737
+YKL157W = 0030287
+YBR286W = 0000324
+YGL180W = 0005829
+YLL042C = 0005737
+YBR217W = 0005624
+YPR185W = 0008372
+YBR128C = 0005624
+YMR159C = 0005624
+YLR423C = 0008372
+YNL242W = 0019898
+YPL149W = 0008372
+YHR171W = 0008372
+YDL149W = 0005624
+YDL149W = 0016021
+YDL149W = 0016021
+YDR525W = 0008372
+YNL077W = 0008372
+YJR005W = 0030122
+YKL135C = 0030121
+YKL135C = 0030121
+YBL037W = 0030122
+YPR029C = 0030121
+YPR029C = 0030121
+YPL195W = 0030123
+YGR261C = 0030123
+YPL259C = 0030121
+YPL259C = 0030121
+YHL019C = 0030121
+YBR288C = 0030123
+YOL062C = 0030122
+YOL062C = 0030122
+YKL114C = 0005634
+YKL114C = 0005739
+YBL019W = 0005634
+YNL094W = 0015629
+YMR192W = 0008372
+YIL040W = 0008372
+YJL075C = 0008372
+YLR170C = 0030121
+YLR170C = 0030121
+YJR058C = 0030122
+YJL024C = 0030123
+YML022W = 0008372
+YDR441C = 0008372
+YNL065W = 0005886
+YBR043C = 0008372
+YPR192W = 0005886
+YLL052C = 0005886
+YLL052C = 0005789
+YBR149W = 0008372
+YGL105W = 0005737
+YGL105W = 0017102
+YGL105W = 0017102
+YIL062C = 0005885
+YIL062C = 0005885
+YLR370C = 0005885
+YKL013C = 0005885
+YKL013C = 0005885
+YNR035C = 0005885
+YNR035C = 0005885
+YBR234C = 0005885
+YHR013C = 0005737
+YCR048W = 0005783
+YNR019W = 0005783
+YDL192W = 0005798
+YDL192W = 0005798
+YDL192W = 0005829
+YDL192W = 0005829
+YDL137W = 0005798
+YDL137W = 0005798
+YDL137W = 0005829
+YDL137W = 0005829
+YOR094W = 0008372
+YOL058W = 0005829
+YJL071W = 0005759
+YJL088W = 0005829
+YHR018C = 0005829
+YER069W = 0005759
+YOL140W = 0005759
+YOL140W = 0005759
+YMR042W = 0005634
+YML099C = 0005634
+YDR173C = 0005634
+YDR376W = 0005743
+YNL020C = 0005857
+YBR164C = 0005625
+YPL051W = 0005625
+YPL051W = 0042175
+YHL040C = 0016023
+YHL040C = 0005768
+YHL047C = 0005886
+YHL047C = 0016023
+YHL047C = 0005768
+YDR127W = 0008372
+YDR380W = 0008372
+YGL148W = 0008372
+YDR035W = 0008372
+YBR249C = 0008372
+YPR060C = 0008372
+YGL202W = 0008372
+YDR421W = 0008372
+YHR137W = 0008372
+YHR129C = 0005869
+YDR106W = 0005737
+YDL029W = 0005885
+YJR065C = 0005885
+YJL081C = 0005717
+YJL081C = 0000123
+YJL081C = 0005634
+YNL059C = 0005634
+YNL059C = 0005634
+YLR085C = 0005737
+YPR034W = 0005679
+YPR034W = 0005634
+YOR141C = 0005634
+YMR033W = 0005679
+YMR033W = 0005634
+YPR199C = 0005634
+YPR200C = 0008372
+YPR201W = 0005887
+YDL100C = 0008372
+YLR242C = 0016021
+YDR101C = 0008372
+YMR116C = 0005737
+YOR058C = 0005876
+YOR058C = 0005880
+YJL115W = 0005678
+YDL197C = 0008372
+YJL170C = 0005886
+YKL185W = 0005634
+YKL185W = 0005634
+YKL185W = 0005634
+YMR119W = 0005789
+YMR119W = 0005789
+YNL159C = 0016021
+YNL008C = 0005789
+YNL008C = 0005789
+YKL052C = 0005698
+YKL052C = 0005819
+YKL052C = 0005699
+YGR097W = 0008372
+YDL088C = 0005643
+YPR145W = 0008372
+YGR124W = 0008372
+YDR321W = 0005623
+YLR155C = 0030287
+YLR155C = 0005635
+YLR155C = 0005783
+YLR157C = 0030287
+YLR158C = 0030287
+YLR160C = 0030287
+YBL069W = 0019898
+YER101C = 0005737
+YDR184C = 0008372
+YGL017W = 0005737
+YOR377W = 0008372
+YGR177C = 0005737
+YPR026W = 0000324
+YMR301C = 0005743
+YDR384C = 0016020
+YBL099W = 0005754
+YBL099W = 0005754
+YLR393W = 0005740
+YNL315C = 0005759
+YJL180C = 0005759
+YLR295C = 0000276
+YLR295C = 0000276
+YPL271W = 0005756
+YPL271W = 0005756
+YPL271W = 0005756
+YDL004W = 0005756
+YDL004W = 0005756
+YDL004W = 0005756
+YDR377W = 0000276
+YDR377W = 0000276
+YML081C-A = 0000276
+YML081C-A = 0000276
+YOL077W-A = 0000276
+YOL077W-A = 0000276
+YJR121W = 0005754
+YPR020W = 0000276
+YPR020W = 0000276
+YPR020W = 0000276
+YBR039W = 0005756
+YBR039W = 0005756
+YPL078C = 0000274
+YPL078C = 0000274
+YDR298C = 0000274
+YDR298C = 0000274
+YDR298C = 0000274
+Q0085 = 0000276
+YKL016C = 0000274
+YKL016C = 0000274
+YKL016C = 0000274
+YML116W = 0005886
+YML116W = 0005886
+YAL020C = 0008372
+YNL259C = 0005829
+YOR079C = 0000139
+YFL010W-A = 0008372
+YKL004W = 0005794
+YOR011W = 0016020
+YNR007C = 0008372
+YFR021W = 0005829
+YNL223W = 0005875
+YCL038C = 0008372
+YBL078C = 0005875
+YBL078C = 0005875
+YOL078W = 0005737
+YMR068W = 0005737
+YPR122W = 0016021
+YPR122W = 0005935
+YPR122W = 0005937
+YIL140W = 0005887
+YIL140W = 0005933
+YIL140W = 0005935
+YIL140W = 0005940
+YIL124W = 0005783
+YIL124W = 0005811
+YIL124W = 0005737
+YLL063C = 0008372
+YOR113W = 0005634
+YGR224W = 0016020
+YOR134W = 0005622
+YBR068C = 0005886
+YDR046C = 0005886
+YIL015W = 0030287
+YKR099W = 0005634
+YHR208W = 0005759
+YJR148W = 0005737
+YJL020C = 0005857
+YPL255W = 0005816
+YJL095W = 0008372
+YER167W = 0008372
+YDR361C = 0008372
+YDR375C = 0005743
+YIL033C = 0005634
+YIL033C = 0005737
+YIL033C = 0005634
+YLR399C = 0005634
+YDL070W = 0005634
+YAL060W = 0005737
+YNL039W = 0000126
+YBR200W = 0000131
+YBR200W = 0005935
+YBR200W = 0005934
+YER155C = 0005622
+YPL115C = 0005622
+YPL161C = 0008372
+YIL004C = 0030138
+YIL004C = 0005789
+YPR176C = 0005968
+YKR068C = 0030008
+YJL031C = 0005968
+YML077W = 0030008
+YJR053W = 0005816
+YOR198C = 0005844
+YOR198C = 0042175
+YDR299W = 0008372
+YGR282C = 0005618
+Q0110 = 0005739
+Q0115 = 0005739
+Q0120 = 0005739
+YHR101C = 0005783
+YHR101C = 0016021
+YCL029C = 0005816
+YCL029C = 0005876
+YER016W = 0005816
+YER016W = 0005881
+YGR286C = 0008372
+YNR058W = 0005737
+YNR057C = 0005737
+YNR056C = 0005886
+YJR089W = 0005699
+YJR089W = 0005699
+YJL058C = 0008372
+YFL007W = 0016020
+YER177W = 0008372
+YDR099W = 0008372
+YPL217C = 0005634
+YPL217C = 0005730
+YPL217C = 0005737
+YJR025C = 0005737
+YJR078W = 0005737
+YJL060W = 0008372
+YBL098W = 0008372
+YLR231C = 0008372
+YFR047C = 0008372
+YNL271C = 0000133
+YNL271C = 0000143
+YNL233W = 0000142
+YNL166C = 0005935
+YNL166C = 0000144
+YNL166C = 0000144
+YIL159W = 0000142
+YGR230W = 0008372
+YBL085W = 0005933
+YBL085W = 0005935
+YBL085W = 0000134
+YER114C = 0005933
+YER114C = 0005935
+YER114C = 0000134
+YPL221W = 0008372
+YLR267W = 0008372
+YNL042W = 0008372
+YLR078C = 0005789
+YCR032W = 0008372
+YDL141W = 0005622
+YDL141W = 0005737
+YLL015W = 0000329
+YDL074C = 0005634
+YLR015W = 0005717
+YDL231C = 0016021
+YNR051C = 0008372
+YGR246C = 0000126
+YBL097W = 0005634
+YBL097W = 0005676
+YBL097W = 0005676
+YBL097W = 0005676
+YBL097W = 0005676
+YBL097W = 0005676
+YPL084W = 0008372
+YPR057W = 0030532
+YER172C = 0005682
+YER172C = 0005687
+YER172C = 0005688
+YGL247W = 0005635
+YOL077C = 0005730
+YBR290W = 0005783
+YFL025C = 0016021
+YFL025C = 0005783
+YGR142W = 0005829
+YPL069C = 0008372
+YDR252W = 0005854
+YGR188C = 0005634
+YGR188C = 0005699
+YMR055C = 0005816
+YMR055C = 0005816
+YOR026W = 0005699
+YGL174W = 0005634
+YAR014C = 0000131
+YAR014C = 0005934
+YAR014C = 0005935
+YEL029C = 0008372
+YNR027W = 0008372
+YJL188C = 0008372
+YKL092C = 0005622
+YLR074C = 0005634
+YOR078W = 0005732
+YMR014W = 0005634
+YCR047C = 0008372
+YER014C-A = 0008372
+YDR241W = 0008372
+YFL023W = 0008372
+YLR062C = 0008372
+YCL014W = 0000142
+YDL151C = 0008372
+YCR063W = 0008372
+YGR262C = 0008372
+YJR092W = 0000142
+YCR038C = 0005935
+YCR038C = 0000131
+YLR319C = 0000133
+YLR319C = 0000143
+YOR299W = 0008372
+YLR353W = 0000131
+YLR353W = 0005934
+YGR041W = 0005935
+YMR275C = 0005886
+YML111W = 0008372
+YLR226W = 0008372
+YER159C = 0005634
+YHR114W = 0005737
+YHR114W = 0005857
+YML102W = 0005678
+YDR423C = 0005634
+YNL278W = 0030014
+YGR134W = 0030014
+YFL028C = 0030014
+YFL028C = 0005737
+YJR122W = 0008372
+YOR276W = 0005845
+YKR036C = 0030014
+YNL288W = 0030014
+YER048C = 0008372
+YFL029C = 0005737
+YPL048W = 0005830
+YPL048W = 0005830
+YEL063C = 0005886
+YKL007W = 0005857
+YKL007W = 0008290
+YIL034C = 0005857
+YIL034C = 0008290
+YPL111W = 0005829
+YLR438W = 0005737
+YML042W = 0005782
+YML042W = 0005739
+YML042W = 0005777
+YOR125C = 0005743
+YMR280C = 0005634
+YGR036C = 0030176
+YPL178W = 0000243
+YPL178W = 0005846
+YJR060W = 0005634
+YGR140W = 0005698
+YGR140W = 0005699
+YLR175W = 0005732
+YNL161W = 0005933
+YNL161W = 0005935
+YNL161W = 0005634
+YNL161W = 0005737
+YJL209W = 0005739
+YHL038C = 0005739
+YPL215W = 0005740
+YGR174C = 0005740
+YBR120C = 0005739
+YIL043C = 0005792
+YDL069C = 0005743
+YDR197W = 0005743
+YKL208W = 0008372
+YER168C = 0005634
+YER168C = 0005634
+YER168C = 0005634
+YER168C = 0005737
+YER168C = 0005737
+YER168C = 0005737
+YER168C = 0005759
+YLR220W = 0005624
+YLR220W = 0005794
+YDR270W = 0005802
+YKL011C = 0005743
+YGR217W = 0005886
+YPR025C = 0005675
+YKR066C = 0005739
+YKR066C = 0005758
+YAL021C = 0030015
+YAL021C = 0005737
+YIL142W = 0005737
+YIL142W = 0005856
+YIL142W = 0005737
+YJL014W = 0005737
+YJL014W = 0005856
+YDL143W = 0005737
+YDL143W = 0005856
+YJR064W = 0005737
+YJR064W = 0005856
+YDR188W = 0005737
+YDR188W = 0005856
+YJL111W = 0005737
+YJL111W = 0005856
+YJL111W = 0005737
+YJL008C = 0005737
+YJL008C = 0005856
+YJL008C = 0005737
+YLR110C = 0009277
+YLR390W-A = 0009277
+YLR390W-A = 0009277
+YBR131W = 0005773
+YBR131W = 0016020
+YBR131W = 0005770
+YLR307W = 0005631
+YLR308W = 0005631
+YDR182W = 0005623
+YCR002C = 0000144
+YJR076C = 0000144
+YJR076C = 0005619
+YJR076C = 0005628
+YJR076C = 0005936
+YHR107C = 0000144
+YHR107C = 0005737
+YLR215C = 0008372
+YDL220C = 0005696
+YFR028C = 0005634
+YFR028C = 0005816
+YFR028C = 0005730
+YAR019C = 0005816
+YKL022C = 0005680
+YAL038W = 0005829
+YDL102W = 0005659
+YGL116W = 0005680
+YOR074C = 0005634
+YHR166C = 0005680
+YAL041W = 0000131
+YAL041W = 0005634
+YAL041W = 0005937
+YAL041W = 0005935
+YLR310C = 0005737
+YLR310C = 0005886
+YFR036W = 0005680
+YBL084C = 0005680
+YBR160W = 0005737
+YBR160W = 0005634
+YLR314C = 0000144
+YLR314C = 0005619
+YLR314C = 0005628
+YLR314C = 0005936
+YOR257W = 0005825
+YOR257W = 0005643
+YOL139C = 0005840
+YOL139C = 0005634
+YOL139C = 0005737
+YDR054C = 0000152
+YDL165W = 0005634
+YDL165W = 0030015
+YDL165W = 0005737
+YDR168W = 0008372
+YCR093W = 0005634
+YCR093W = 0030015
+YCR093W = 0005737
+YFL009W = 0000151
+YDR364C = 0005681
+YDR364C = 0005635
+YDR364C = 0005643
+YLR229C = 0005625
+YLR229C = 0005886
+YLR229C = 0005934
+YLR229C = 0005935
+YLR229C = 0005937
+YGL155W = 0005622
+YLR103C = 0005656
+YLR103C = 0005657
+YLR274W = 0005737
+YLR274W = 0005656
+YLR274W = 0005657
+YBR202W = 0005737
+YBR202W = 0005634
+YBR202W = 0005737
+YBR202W = 0005656
+YDL126C = 0005634
+YDL126C = 0005792
+YDL126C = 0005783
+YDL126C = 0005829
+YMR001C = 0005737
+YMR001C = 0005816
+YCR094W = 0008372
+YDL132W = 0000152
+YPR019W = 0005737
+YPR019W = 0005634
+YPR019W = 0005737
+YPR019W = 0005656
+YGL190C = 0000159
+YJL194W = 0005656
+YPL160W = 0005737
+tQ(CUG)M = 0005829
+YDL017W = 0005654
+YLR418C = 0008023
+YJR057W = 0005634
+YJR057W = 0005737
+YDL164C = 0005657
+YLR459W = 0008372
+YLR245C = 0008372
+YGL003C = 0005680
+YBR029C = 0005783
+YBR029C = 0005739
+YMR213W = 0005681
+YGL130W = 0005634
+YER061C = 0005739
+YMR168C = 0005698
+YMR168C = 0005699
+YPL228W = 0005634
+YDR301W = 0005847
+YDR301W = 0005849
+YLR115W = 0005847
+YLR115W = 0005849
+YGL029W = 0005730
+YCL064C = 0008372
+YLR098C = 0005634
+YGL206C = 0030125
+YER164W = 0008023
+YBR274W = 0005634
+YPL008W = 0005634
+YDR254W = 0005699
+YER026C = 0005783
+YGR157W = 0005783
+YNL192W = 0005886
+YNL192W = 0045009
+YBR038W = 0000142
+YBR023C = 0000142
+YLR330W = 0005737
+YJL099W = 0008372
+YHR142W = 0005789
+YHR052W = 0005837
+YHR052W = 0005837
+YMR198W = 0005881
+YMR198W = 0005871
+YMR198W = 0005816
+YMR198W = 0005819
+YMR198W = 0005711
+YMR198W = 0005816
+YOR349W = 0005874
+YPL241C = 0008372
+YMR138W = 0008372
+YOR028C = 0005634
+YEL061C = 0005871
+YEL061C = 0005876
+YDR022C = 0008372
+YJL158C = 0005618
+YJL158C = 0005934
+YJL158C = 0005783
+YJL158C = 0005886
+YNR001C = 0005759
+YNR001C = 0005739
+YCR005C = 0005782
+YPR001W = 0005759
+YPR001W = 0005759
+YIL035C = 0005956
+YOR061W = 0005956
+YGL019W = 0005956
+YOR039W = 0005956
+YLR133W = 0005829
+YBR135W = 0008372
+YNL298W = 0000143
+YGR108W = 0008372
+YPR119W = 0005634
+YPR119W = 0005737
+YPR119W = 0005737
+YDL155W = 0008372
+YLR210W = 0008372
+YPR120C = 0005634
+YGR109C = 0008372
+YGR167W = 0030125
+YLR117C = 0005681
+YGL215W = 0000307
+YMR199W = 0008372
+YPL256C = 0005737
+YAL040C = 0005634
+YOR250C = 0005849
+YMR012W = 0005840
+YMR012W = 0005622
+YMR012W = 0005737
+YBR109C = 0000131
+YBR109C = 0005737
+YBR109C = 0005823
+YBR109C = 0005934
+YBR109C = 0005935
+YBR109C = 0005937
+YFR014C = 0005737
+YOL016C = 0008372
+YML057W = 0005737
+YLR433C = 0005737
+YKL190W = 0005737
+YAL058W = 0030176
+YNL225C = 0005816
+YBR155W = 0005737
+Q0105 = 0005750
+Q0105 = 0005750
+YLL050C = 0005857
+YGL223C = 0017119
+YGR120C = 0000300
+YGR120C = 0005625
+YGR120C = 0017119
+YER157W = 0000300
+YER157W = 0005625
+YER157W = 0017119
+YPR105C = 0017119
+YNL051W = 0017119
+YNL041C = 0017119
+YGL005C = 0017119
+YML071C = 0017119
+YDL145C = 0030126
+YDL145C = 0030126
+YBR003W = 0005739
+YNR041C = 0005743
+YOL096C = 0005739
+YDR204W = 0005743
+YML110C = 0005739
+YGR255C = 0005739
+YBL045C = 0005750
+YBL045C = 0005750
+YNL336W = 0008372
+YNR075W = 0005737
+YNR075W = 0005635
+YNR075W = 0005783
+YGL263W = 0008372
+YBR302C = 0008372
+YML132W = 0008372
+YFL062W = 0008372
+YJR161C = 0008372
+YGR295C = 0008372
+YDL248W = 0008372
+YHL048W = 0005635
+YKL219W = 0008372
+YOR316C = 0000324
+Q0045 = 0005751
+YPL172C = 0005743
+YPL132W = 0005743
+YLR038C = 0005751
+YGL191W = 0005751
+YML129C = 0005740
+YML129C = 0016021
+YER141W = 0005743
+YJL003W = 0008372
+YLL009C = 0005758
+YLL009C = 0005829
+YGR062C = 0016021
+YGR062C = 0005743
+YLL018C-A = 0005758
+YLL018C-A = 0005829
+Q0250 = 0005751
+YDR231C = 0005743
+Q0275 = 0005751
+YGL187C = 0005751
+YNL052W = 0005751
+YIL111W = 0005751
+YHR051W = 0005751
+YMR256C = 0005751
+YLR395C = 0005751
+YDL067C = 0005751
+YKL179C = 0000139
+YOR303W = 0005829
+YJR109C = 0005829
+YGR247W = 0008372
+YDR155C = 0000118
+YHR057C = 0008372
+YML078W = 0005739
+YCR069W = 0016020
+YDR304C = 0005737
+YDR304C = 0005783
+YDR304C = 0005783
+YLR216C = 0005737
+YJR032W = 0005829
+YNR028W = 0008372
+YJL172W = 0000324
+YNL130C = 0005783
+YOR100C = 0005743
+YOR100C = 0005739
+YDL142C = 0005740
+YGR189C = 0005618
+YGR189C = 0000131
+YGR218W = 0005634
+YLR429W = 0005857
+YHR146W = 0005634
+YLR213C = 0008372
+YOR031W = 0005737
+YNL027W = 0005634
+YNL027W = 0005737
+YGL238W = 0005635
+YNR010W = 0000119
+YKL049C = 0005718
+YLR087C = 0008372
+YBR036C = 0030176
+YMR025W = 0008180
+YNL232W = 0000176
+YNL232W = 0000177
+YCR086W = 0008372
+YIL132C = 0008372
+YMR048W = 0008372
+YPL200W = 0008372
+YJR084W = 0008372
+YDR179C = 0008180
+YLR380W = 0008372
+YPR030W = 0005634
+YIL036W = 0005634
+YLR394W = 0008372
+YDR256C = 0005782
+YMR094W = 0005699
+YMR078C = 0005663
+YPL018W = 0005698
+YPL018W = 0005708
+YPL018W = 0005634
+YPL018W = 0005699
+YPL018W = 0005699
+YLR381W = 0005699
+YPR135W = 0005634
+YHR191C = 0005663
+YDR151C = 0005634
+YKL139W = 0005634
+YJL006C = 0005634
+YML112W = 0005634
+YMR180C = 0005634
+YMR180C = 0005737
+YHR109W = 0005829
+YBR291C = 0005743
+YPR124W = 0005886
+YHR175W = 0000329
+YLR411W = 0005887
+YCR054C = 0008372
+YOL145C = 0005634
+YOL145C = 0016593
+YOL145C = 0008023
+YLR286C = 0005635
+YLR286C = 0005783
+YLR286C = 0009277
+YLR286C = 0005576
+YDR371W = 0008372
+YGR088W = 0005737
+YMR264W = 0030176
+YKL090W = 0008372
+YGL110C = 0008372
+YML101C = 0005737
+YOR042W = 0008372
+YHR053C = 0005829
+YHR055C = 0005829
+YGL166W = 0005634
+YEL027W = 0000220
+YEL027W = 0000220
+YPL177C = 0005634
+YMR240C = 0005686
+YNL286W = 0005686
+YCR068W = 0016021
+YCR068W = 0016021
+YCR068W = 0005775
+YOL082W = 0005773
+YOL082W = 0000300
+YOL082W = 0005737
+YDL113C = 0016020
+YPR049C = 0019898
+YDR163W = 0008372
+YDL209C = 0005681
+YDR482C = 0008372
+YGR278W = 0008372
+YGL128C = 0008372
+YLR323C = 0008372
+YNL245C = 0008372
+YPL064C = 0008372
+YCL007C = 0008372
+YGL027C = 0005789
+YCR017C = 0005887
+YCR017C = 0005934
+YCR017C = 0005935
+YKL096W = 0009277
+YKL096W-A = 0009277
+YML054C = 0005758
+YNL111C = 0005792
+YJR048W = 0005758
+YOR037W = 0005739
+YAL039C = 0005758
+YEL039C = 0005758
+YBR112C = 0005634
+YDL117W = 0008372
+YDR430C = 0008372
+YJL005W = 0005886
+YAL012W = 0008372
+YGR155W = 0005737
+YOR065W = 0005743
+YOR065W = 0005746
+YOR065W = 0005750
+YKL087C = 0005758
+YDR016C = 0005699
+YDR016C = 0005819
+YKR083C = 0005819
+YKR083C = 0005699
+YBR233W-A = 0008372
+YDR320C-A = 0008372
+YML070W = 0008372
+YFL053W = 0008372
+YIR027C = 0005622
+YIR029W = 0008372
+YIR032C = 0016020
+YIR028W = 0016020
+YJR152W = 0005886
+YJR152W = 0005886
+YIR031C = 0005782
+YKR034W = 0005634
+YIR023W = 0005634
+YNL314W = 0005634
+YGR113W = 0005828
+YGR113W = 0005699
+YGR113W = 0005819
+YJR150C = 0009277
+YLR037C = 0009277
+YBR301W = 0009277
+YJR151C = 0009277
+YPL170W = 0008372
+YHR028C = 0000329
+YML113W = 0008372
+YGR092W = 0005816
+YGR092W = 0005935
+YPR111W = 0008372
+YDR052C = 0005654
+YPL119C = 0008372
+YDL031W = 0005730
+YNL112W = 0005935
+YGL078C = 0005730
+YOR046C = 0005643
+YOR046C = 0005737
+YNR038W = 0005730
+YKR024C = 0005730
+YHR169W = 0005730
+YHR169W = 0005730
+YLR276C = 0005730
+YKL149C = 0005634
+YCL016C = 0005663
+YHR144C = 0008372
+YIR030C = 0008372
+YOR180C = 0005782
+YOL149W = 0008372
+YNL118C = 0005737
+YNL118C = 0005634
+YEL015W = 0008372
+YMR135C = 0008372
+YLR361C = 0008372
+YLR270W = 0008372
+YOR173W = 0008372
+YKL046C = 0046658
+YKL046C = 0005624
+YPL194W = 0005711
+YER143W = 0005886
+YOR163W = 0008372
+YOL052C-A = 0008372
+YMR173W = 0008372
+YOR204W = 0005737
+YHR019C = 0005737
+YKL054C = 0005634
+YFL001W = 0005634
+YFL001W = 0005737
+YBR163W = 0008372
+YAL013W = 0008372
+YBR201W = 0005789
+YIL049W = 0008372
+YOR030W = 0008372
+YMR238W = 0046658
+YOR236W = 0005829
+YOR245C = 0005811
+YDL160C = 0005737
+YKL078W = 0005730
+YMR316W = 0005737
+YOR080W = 0008372
+YDL024C = 0008372
+YHR011W = 0008372
+YPR082C = 0030532
+YLR348C = 0005740
+YKR035W-A = 0005737
+YKL002W = 0005737
+YKL002W = 0005768
+YGR227W = 0005789
+YPL049C = 0005634
+YDR480W = 0005634
+YPL266W = 0005730
+YOR145C = 0005737
+YDR263C = 0005739
+YLR129W = 0005732
+YPL265W = 0005886
+YOL021C = 0000176
+YOL021C = 0000177
+YDR403W = 0008372
+YDR402C = 0008372
+YIR004W = 0005829
+YDL174C = 0005743
+YDL178W = 0005759
+YEL071W = 0005625
+YEL071W = 0005737
+YMR126C = 0008372
+YER179W = 0005634
+YER179W = 0005711
+YMR211W = 0008372
+MAK1-3 = 0005623
+YHR164C = 0005634
+YER166W = 0005886
+YDR093W = 0005886
+YMR162C = 0030140
+YOR005C = 0005634
+YLL001W = 0005741
+YKL213C = 0008372
+YDR069C = 0005837
+YGL240W = 0005680
+YHR044C = 0008372
+YHR043C = 0005737
+YNL001W = 0008372
+YDR273W = 0005819
+YDR273W = 0005628
+YDR273W = 0005628
+YDR141C = 0008372
+YDR068W = 0008372
+YDR440W = 0005634
+YIL010W = 0005634
+YIL010W = 0005634
+YER088C = 0008372
+YJL090C = 0005657
+YPR175W = 0005657
+YBR278W = 0005657
+YDR121W = 0008622
+YKL191W = 0008372
+YLR172C = 0008372
+YDR294C = 0008372
+YPR183W = 0005783
+YDR284C = 0005737
+YDR284C = 0005783
+YLL018C = 0005737
+YKR071C = 0008372
+YIL003W = 0008372
+YLL008W = 0005730
+YAL026C = 0000139
+YAL026C = 0030140
+YER124C = 0008372
+YHR143W = 0005618
+YHR143W = 0005576
+YOR264W = 0008372
+YNR067C = 0030428
+YNR067C = 0005576
+YMR276W = 0005634
+YNL258C = 0005783
+YIR010W = 0030615
+YPR017C = 0005624
+YPR017C = 0005625
+YGL043W = 0005654
+YDL219W = 0008372
+YBR180W = 0005628
+YDL101C = 0008372
+YGL061C = 0005699
+YGL061C = 0005819
+YBR208C = 0008372
+YHL016C = 0005886
+YHL016C = 0005886
+YML080W = 0008372
+YBR252W = 0008372
+YKR054C = 0005816
+YKR054C = 0005881
+YDR424C = 0005623
+YHR068W = 0008372
+YPR023C = 0000123
+YEL018W = 0008372
+YJR082C = 0008372
+YKL204W = 0005845
+YKL172W = 0005730
+YDR206W = 0005634
+YLR284C = 0005777
+YLR284C = 0005777
+YAL059W = 0008372
+YEL030W = 0005739
+YDR446W = 0005634
+YHR021W-A = 0008372
+YBL043W = 0008372
+YHR132C = 0008372
+YBL001C = 0008372
+YMR128W = 0005730
+YMR128W = 0005732
+YJR137C = 0008372
+YDR125C = 0008372
+YLR390W = 0008372
+YBR065C = 0008372
+YBL101C = 0008372
+YLR228C = 0005634
+YPL021W = 0008372
+YJL201W = 0008372
+YJR106W = 0008372
+YHL030W = 0008372
+YOR092W = 0008372
+YLR436C = 0008372
+YBR176W = 0008372
+YER176W = 0005844
+YBR078W = 0009277
+YHL043W = 0008372
+YIL146C = 0008372
+YLR299W = 0005622
+YNR030W = 0008372
+YKR076W = 0008372
+YMR062C = 0005759
+YMR176W = 0008372
+YLR443W = 0008372
+YBR076W = 0008372
+YKR004C = 0008372
+YFR027W = 0005695
+YGL222C = 0008372
+YER035W = 0008372
+YBL047C = 0005857
+YBL047C = 0005934
+YBL047C = 0005935
+YBR033W = 0008372
+YAL003W = 0005840
+YMR212C = 0008372
+YOR133W = 0005840
+YDR385W = 0005840
+YPL037C = 0005854
+YHR193C = 0005854
+YNL327W = 0009277
+YBR177C = 0005811
+YDR147W = 0008372
+YNL230C = 0008023
+YPL046C = 0008023
+YKL160W = 0008372
+YOR144C = 0008372
+YKL048C = 0000142
+YJL196C = 0016020
+YGR200C = 0008023
+YPL086C = 0016591
+YPL086C = 0008023
+YPL101W = 0005737
+YPL101W = 0008023
+YMR312W = 0008023
+YLR186W = 0005737
+YLR186W = 0005634
+YLR186W = 0005737
+YLR186W = 0005634
+YDR512C = 0008372
+YDR516C = 0005737
+YOL071W = 0008372
+YGL200C = 0016021
+YGL200C = 0005783
+YGL200C = 0030138
+YLR080W = 0000139
+YFL048C = 0005794
+YFL048C = 0030138
+YLR083C = 0005768
+YLR083C = 0005624
+tM(CAU)D = 0005829
+tM(CAU)O2 = 0005829
+tM(CAU)J2 = 0005829
+tM(CAU)M = 0005829
+tM(CAU)J1 = 0005829
+YDR040C = 0005886
+YDR039C = 0005886
+YDR038C = 0005886
+YOL158C = 0016021
+YOL158C = 0016023
+YOL158C = 0005768
+YNL084C = 0005857
+YGR254W = 0000015
+YGR254W = 0005737
+YHR174W = 0000015
+YBR247C = 0005634
+YGR145W = 0008372
+RF3 = 0005739
+YDL161W = 0005857
+YLR206W = 0005857
+YJR125C = 0005857
+YJR125C = 0030125
+YLL038C = 0005857
+YDR153C = 0005737
+YDR153C = 0030125
+YFL024C = 0000123
+YIL005W = 0005789
+YHR123W = 0005783
+YMR049C = 0008372
+YDR414C = 0016020
+YBL040C = 0030176
+YLR246W = 0030176
+YGR175C = 0005783
+YGR175C = 0005811
+YPL028W = 0005829
+YHR007C = 0005783
+YHR007C = 0005783
+YMR208W = 0005829
+YML126C = 0005783
+YML126C = 0005739
+YMR202W = 0005783
+YJL167W = 0005829
+YNL280C = 0005783
+YGR060W = 0005789
+YGR060W = 0005886
+YGL001C = 0005783
+YGL001C = 0005789
+YLR100W = 0005783
+YLR100W = 0005789
+YER044C = 0005789
+YLR056W = 0005783
+YGL012W = 0005783
+YMR015C = 0005783
+YML008C = 0005783
+YML008C = 0005811
+YHR072W = 0005783
+YHR072W = 0005886
+YHR072W = 0005811
+YMR220W = 0005829
+YHR190W = 0005783
+YPL096C-A = 0008372
+YML130C = 0005783
+YAR002C-A = 0030138
+YAL007C = 0030138
+YDL018C = 0016021
+YOR016C = 0016021
+YHR110W = 0016021
+YGL002W = 0016021
+YOR393W = 0008372
+YPL281C = 0008372
+YCR075C = 0016021
+YGR029W = 0005739
+YGL054C = 0005789
+YGL054C = 0030138
+YPR037C = 0005792
+YML012W = 0030138
+YGR284C = 0030138
+YML067C = 0030173
+YML067C = 0030176
+YML067C = 0030138
+YAL042W = 0030173
+YAL042W = 0030176
+YAL042W = 0030138
+YOR244W = 0000123
+YOR244W = 0000123
+YNL125C = 0005739
+YNL125C = 0016020
+YMR219W = 0005634
+YDR363W = 0005634
+YOL017W = 0005634
+YGR098C = 0005819
+YGR098C = 0005634
+YGR098C = 0005737
+YJR017C = 0008372
+YLR233C = 0005697
+YLR233C = 0005634
+YLR233C = 0005730
+YLR318W = 0000333
+YLR318W = 0005634
+YLR318W = 0005730
+YIL009C-A = 0005697
+YIL009C-A = 0005634
+YBR026C = 0005739
+YDR518W = 0005783
+YLR300W = 0009277
+YDR261C = 0009277
+YOR033C = 0005634
+YJL085W = 0000143
+YJL085W = 0000145
+YBR102C = 0000143
+YBR102C = 0000145
+YOR317W = 0005811
+YER015W = 0005777
+YIL009W = 0008372
+YMR246W = 0005737
+YMR246W = 0005811
+YFR019W = 0005774
+YDL045C = 0005737
+YDR021W = 0005730
+YNL023C = 0008372
+YDL166C = 0005634
+YJL157C = 0005737
+YJL157C = 0005634
+YMR052W = 0008372
+YKL182W = 0005829
+YKL182W = 0005835
+YPL231W = 0005835
+YBR041W = 0005777
+YBR041W = 0005792
+YBR041W = 0005811
+YBR041W = 0005886
+YBR041W = 0005886
+YBR222C = 0005737
+YER183C = 0008372
+YKL060C = 0005829
+YKL060C = 0005737
+YLR377C = 0005829
+YJL155C = 0005829
+YMR277W = 0005634
+YPR062W = 0008372
+YER056C = 0005886
+YER060W = 0016021
+YER060W-A = 0016021
+YOR388C = 0008372
+YPL275W = 0008372
+YCR034W = 0005789
+YCR034W = 0005783
+YCR028C = 0005886
+YCR028C = 0005886
+YMR058W = 0005886
+YMR319C = 0005887
+YFL041W = 0005624
+YPR104C = 0005634
+YBR040W = 0009277
+YCR089W = 0009277
+YNL325C = 0019898
+YHR038W = 0005739
+YDR130C = 0005634
+YJR093C = 0005847
+YER032W = 0008372
+YIL065C = 0005741
+YDR534C = 0009277
+YOR382W = 0009277
+YOR383C = 0009277
+YIL131C = 0005634
+YNL068C = 0005634
+YLR342W = 0000143
+YLR342W = 0000148
+YMR306W = 0008372
+YAR050W = 0009277
+YKR102W = 0008372
+YHR211W = 0009277
+YER109C = 0005634
+YER109C = 0005634
+YER109C = 0005737
+YAL063C = 0008372
+YBR008C = 0005887
+YIL134W = 0005739
+YIL098C = 0005739
+YDR236C = 0005743
+YDR236C = 0005792
+YHR176W = 0005789
+YMR020W = 0005737
+YBL013W = 0005739
+YDR110W = 0005730
+YNL256W = 0005737
+YGR267C = 0005737
+YMR113W = 0008372
+YKR009C = 0005782
+YNL135C = 0008372
+YDR519W = 0005789
+YDR519W = 0005789
+YML074C = 0005730
+YML074C = 0005730
+YLR449W = 0005634
+YLL043W = 0005887
+YLL043W = 0005737
+YLL043W = 0005886
+YLR214W = 0005886
+YKL220C = 0005886
+YOR381W = 0005886
+YOR381W = 0016021
+YNR060W = 0005886
+YNR060W = 0005886
+YOR384W = 0008372
+YLL051C = 0008372
+YOL152W = 0008372
+YCL026C-A = 0008372
+YDR373W = 0016020
+YLR060W = 0009328
+YFL022C = 0005737
+YFL022C = 0009328
+YHR049W = 0008372
+YMR222C = 0008372
+YOR280C = 0008372
+YJL221C = 0008372
+YBR207W = 0008372
+YER145C = 0005886
+YBL042C = 0005886
+YBL042C = 0005886
+YPL262W = 0005759
+YPL262W = 0005829
+YAL036C = 0008372
+YAL035W = 0005843
+YAL008W = 0008372
+YAL034C = 0008372
+YAL031C = 0008372
+YAL022C = 0005622
+YAL022C = 0016020
+YAL019W = 0008372
+YNR002C = 0016020
+YNR002C = 0016020
+YHR128W = 0008372
+YBR021W = 0005886
+YCL027W = 0005886
+YMR232W = 0005937
+YBL016W = 0005634
+YBL016W = 0005737
+YBL016W = 0005937
+YDR024W = 0008372
+YIL097W = 0008372
+YOR183W = 0008372
+YHR059W = 0008372
+YCL058C = 0008372
+YNL133C = 0008372
+YLR068W = 0008372
+YGR196C = 0005737
+YGL254W = 0008372
+YBR179C = 0005741
+YLR088W = 0030176
+YOR178C = 0000164
+YMR250W = 0005737
+YBR020W = 0005886
+YBR020W = 0005794
+YBR019C = 0005737
+YOL051W = 0000119
+YLR081W = 0005886
+YDR009W = 0005634
+YPL248C = 0005634
+YBR018C = 0005737
+YML051W = 0005634
+YER027C = 0005634
+YKR039W = 0005887
+YHR089C = 0005730
+YHR089C = 0005732
+YMR307W = 0005886
+YMR215W = 0009277
+YOL132W = 0009277
+YOL030W = 0009277
+YFL021W = 0005634
+YMR136W = 0005634
+YLR013W = 0005634
+YIR013C = 0005634
+YCL011C = 0005634
+YOR260W = 0005840
+YOR260W = 0005851
+YNL062C = 0005634
+YER025W = 0005840
+YJL125C = 0005634
+YGR083C = 0005840
+YGR083C = 0005851
+YDR211W = 0005840
+YDR211W = 0005851
+YLR291C = 0005840
+YLR291C = 0005851
+YGL195W = 0005829
+YGL195W = 0005830
+YDR283C = 0005830
+YFR009W = 0005829
+YFR009W = 0005830
+YKR026C = 0005851
+YEL009C = 0005634
+YGR252W = 0000124
+YPL075W = 0005634
+YNL199C = 0005634
+YDL226C = 0005793
+YDL226C = 0005856
+YDL226C = 0005856
+YDR019C = 0005739
+YMR189W = 0005739
+YAL044C = 0005739
+YOR120W = 0008372
+YEL042W = 0005794
+YPR184W = 0008372
+YOR375C = 0005737
+YOR375C = 0005634
+YDL215C = 0005625
+YAL062W = 0005625
+YAL062W = 0005634
+YER136W = 0005624
+YER136W = 0005625
+YOR355W = 0008372
+YJR031C = 0005798
+YEL022W = 0005798
+YJR040W = 0005798
+YKL104C = 0008372
+YMR255W = 0005643
+YMR255W = 0005643
+YMR255W = 0005737
+YCL036W = 0008372
+YDR358W = 0005802
+YHR108W = 0005802
+YHR061C = 0000143
+YHR061C = 0005935
+YHR061C = 0005934
+YHR061C = 0000131
+YDR309C = 0000143
+YDR309C = 0005934
+YDR309C = 0005937
+YDR309C = 0000131
+YIR024C = 0008372
+YNL153C = 0005737
+YEL003W = 0005737
+YML094W = 0005737
+YIL130W = 0008372
+YDR507C = 0005935
+YBR045C = 0000164
+YBR045C = 0005628
+YER054C = 0000164
+YDR096W = 0008372
+YNL255C = 0008372
+YLR094C = 0008372
+YML006C = 0008372
+YCR098C = 0005886
+YCR098C = 0005886
+YEL011W = 0008372
+YER133W = 0000164
+YMR311C = 0005737
+YDL207W = 0005643
+YER107C = 0005643
+YKR058W = 0008372
+YJL137C = 0008372
+YCL040W = 0005829
+YPR035W = 0005737
+YER040W = 0005634
+YER040W = 0005829
+YOR168W = 0005737
+YML004C = 0008372
+YDR272W = 0005737
+YER122C = 0005793
+YOR040W = 0005739
+YOR040W = 0005759
+YPL091W = 0008372
+YDL171C = 0005623
+YEL046C = 0008372
+YFL017C = 0008372
+YHR183W = 0005737
+YGR256W = 0005829
+YDR508C = 0005886
+YOR320C = 0008372
+YGR002C = 0008372
+YHL031C = 0016021
+YHL031C = 0016021
+YMR292W = 0000139
+YHR005C = 0005834
+YHR005C = 0005886
+YER020W = 0008372
+YOR371C = 0008372
+YAL056W = 0008372
+YDL022W = 0005737
+YOL059W = 0005829
+YGL121C = 0008372
+YPR160W = 0005737
+YGR216C = 0016020
+YGR216C = 0016020
+YGL142C = 0016021
+YDR302W = 0005783
+YMR281W = 0005789
+YLL031C = 0005783
+YNL038W = 0008372
+YHR188C = 0030176
+YDR434W = 0030176
+YDR434W = 0030176
+YPL076W = 0008372
+YDR331W = 0030176
+YKL152C = 0005829
+YDL021W = 0005829
+YDL021W = 0005737
+YOL056W = 0005829
+YDL035C = 0005886
+YDL035C = 0005886
+YKR067W = 0005737
+YKR067W = 0005783
+YKL026C = 0008372
+YBR244W = 0008372
+YLL035W = 0008372
+YOR357C = 0005829
+YPL223C = 0005737
+YOL151W = 0008372
+YHR104W = 0008372
+YDR517W = 0005737
+YDR517W = 0005737
+YJR090C = 0000152
+YBR121C = 0005737
+YBR121C = 0005739
+YPR081C = 0008372
+YCL035C = 0005737
+YDR098C = 0005622
+YER174C = 0005622
+YPL059W = 0005759
+YGR032W = 0000143
+YGR032W = 0000148
+YML048W = 0030176
+YML048W = 0005737
+YDR108W = 0030008
+YJL101C = 0005622
+YOL049W = 0005622
+YLR293C = 0005737
+YLR293C = 0005634
+YOR185C = 0005634
+YOR185C = 0005634
+YFR015C = 0008372
+YLR258W = 0005737
+YML121W = 0005634
+YML121W = 0005737
+YGR163W = 0005634
+YGR163W = 0005634
+YGR163W = 0005737
+YGR163W = 0005737
+YGL181W = 0005737
+YGL181W = 0005634
+YIR038C = 0005783
+YLL060C = 0005623
+YEL017W = 0008372
+YMR217W = 0008372
+YLR289W = 0008372
+YDR454C = 0008372
+YGL084C = 0016020
+YGL084C = 0016020
+YPL189W = 0016020
+YHL032C = 0008372
+YIL155C = 0005739
+YIL155C = 0005739
+YOR070C = 0005794
+YPL249C = 0005625
+YPL249C = 0005829
+YJL044C = 0008372
+YDL234C = 0008372
+YFL027C = 0005622
+YJL110C = 0005634
+YPR008W = 0005634
+YFL031W = 0005634
+YPR005C = 0005737
+YJL165C = 0008372
+YOL089C = 0005634
+YJR069C = 0008372
+YLR256W = 0005634
+YGL237C = 0005634
+YGL237C = 0016602
+YBL021C = 0016602
+YKL109W = 0016602
+YOR358W = 0016602
+YMR290C = 0005730
+YMR290C = 0005635
+YPL001W = 0005737
+YPL001W = 0005634
+YEL056W = 0005737
+YEL056W = 0005737
+YEL056W = 0005634
+YKR084C = 0008372
+YDL223C = 0005936
+YJL033W = 0005730
+YNL281W = 0008372
+YCR065W = 0005634
+YLR192C = 0005852
+YKL017C = 0005658
+YNL021W = 0000118
+YBR138C = 0008372
+YNL014W = 0005830
+YBL032W = 0005737
+YBL032W = 0005696
+YDR232W = 0005759
+YDR047W = 0008372
+YDR044W = 0005743
+YER014W = 0005739
+YOR176W = 0005743
+YOR176W = 0005743
+YGL040C = 0008372
+YDL205C = 0008372
+YOR278W = 0008372
+YOR237W = 0008372
+YDL013W = 0005634
+YMR207C = 0008372
+YPL254W = 0000124
+YGL251C = 0005634
+YGR187C = 0008372
+YBR009C = 0005718
+YNL030W = 0005718
+YPL127C = 0005718
+YPL127C = 0005634
+YBR010W = 0005718
+YBR010W = 0005634
+YNL031C = 0005718
+YLL022C = 0008372
+YGR191W = 0005886
+YGR191W = 0005886
+YBL008W = 0005634
+YOR038C = 0005634
+YJR140C = 0005634
+YER055C = 0005623
+YFR025C = 0005623
+YOR202W = 0005829
+YCL030C = 0005623
+YIL116W = 0005623
+YIL020C = 0005623
+YBR248C = 0005623
+YJR055W = 0008372
+YDR420W = 0005886
+YDR420W = 0005886
+YMR161W = 0008372
+YDR528W = 0008372
+YER057C = 0005829
+YML075C = 0005759
+YML075C = 0005635
+YML075C = 0005789
+YLR450W = 0005759
+YLR450W = 0005635
+YLR450W = 0005789
+YOL095C = 0005759
+YCL066W = 0005634
+YCL067C = 0005634
+YDR174W = 0005717
+YDR174W = 0005634
+YDR174W = 0005737
+YCR097W = 0005634
+YCR096C = 0008372
+YOR032C = 0008372
+YJR147W = 0008372
+YBR034C = 0005634
+YLR205C = 0016020
+YGL077C = 0005886
+YGL077C = 0005886
+YDL125C = 0005737
+YDR305C = 0008372
+YOR258W = 0008372
+YDL227C = 0005634
+YJR075W = 0000136
+YJR075W = 0000136
+YMR032W = 0000142
+YLR113W = 0005737
+YLR113W = 0005634
+YLR113W = 0005737
+YNR055C = 0005886
+YNR055C = 0005886
+YDR158W = 0008372
+YER052C = 0008372
+YJR139C = 0008372
+YIL072W = 0005711
+YIL072W = 0005716
+YGL033W = 0005711
+YER062C = 0008372
+YMR251W-A = 0005624
+YMR251W-A = 0009277
+YPR068C = 0000118
+YGL194C = 0000118
+YGL194C = 0000118
+YPL116W = 0005737
+YPL116W = 0005634
+YIL112W = 0000118
+YMR172W = 0000228
+YPR193C = 0005737
+YEL066W = 0008372
+YBR215W = 0005634
+YDR138W = 0005634
+YJL092W = 0005634
+YDR399W = 0008372
+YNL004W = 0005634
+YNL004W = 0005737
+YNL004W = 0030530
+YNL004W = 0030530
+YOL013C = 0005789
+YOL013C = 0005789
+YLR207W = 0005783
+YOR267C = 0008372
+YOL123W = 0005849
+YOL123W = 0005634
+YPL204W = 0005634
+YOL133W = 0000152
+YMR027W = 0008372
+YLR097C = 0008372
+YMR186W = 0008372
+YOR311C = 0016021
+YOR311C = 0030176
+YHL002W = 0005768
+YGL073W = 0005634
+YMR288W = 0005686
+YOR319W = 0005686
+YKL138C-A = 0008372
+YKL101W = 0005940
+YKL101W = 0005940
+YKL101W = 0005935
+YBR133C = 0005935
+YBR133C = 0005935
+YBR272C = 0008372
+YOR020C = 0005759
+YLL026W = 0005737
+YLL026W = 0005737
+YFL014W = 0008372
+YJL159W = 0005618
+YBR072W = 0005634
+YBR072W = 0005737
+YBR072W = 0005737
+YCR021C = 0005886
+YCR021C = 0005886
+YDR171W = 0005856
+YDR171W = 0005737
+YLR259C = 0005739
+YDR258C = 0005759
+YPL240C = 0005737
+YOL068C = 0000118
+YOL068C = 0000118
+YOL068C = 0005634
+YPL015C = 0005737
+YOR025W = 0005696
+YOR025W = 0005634
+YDR191W = 0008372
+tR(CCU)J = 0005829
+YDR225W = 0005718
+YBL003C = 0005718
+YDR224C = 0005718
+YDR224C = 0005718
+YBL002W = 0005718
+YCR020W-B = 0016586
+YPR033C = 0005737
+YPR033C = 0005739
+YOL012C = 0005678
+YOL012C = 0005717
+YOL012C = 0005717
+YOL012C = 0005717
+YOL012C = 0005717
+YGR268C = 0005737
+YOR284W = 0008372
+YPR171W = 0008372
+YNR032C-A = 0005936
+YML058W-A = 0008372
+YJR036C = 0008372
+YGL141W = 0008372
+YGL168W = 0008372
+YPL244C = 0008372
+YER039C = 0008372
+YFR053C = 0005829
+YGL253W = 0005634
+YGL253W = 0005829
+YHR094C = 0005886
+YFL011W = 0005886
+YOL156W = 0005886
+YIL170W = 0008372
+YEL069C = 0005886
+YNL318C = 0005886
+YDL245C = 0005886
+YJR158W = 0005886
+YNR072W = 0005886
+YMR011W = 0005886
+YDR345C = 0005886
+YHR092C = 0005886
+YHR096C = 0005886
+YDR343C = 0005886
+YDR342C = 0005886
+YJL214W = 0005886
+YJL219W = 0005886
+YKL189W = 0005622
+YEL034W = 0005840
+YEL034W = 0005737
+YIR037W = 0005622
+YJR006W = 0005659
+YOR126C = 0008372
+YNL164C = 0005634
+YER065C = 0008372
+YPR006C = 0005759
+YBR157C = 0008372
+YJL077C = 0008372
+YLR099C = 0008372
+YMR195W = 0008372
+YPL250C = 0008372
+YNL037C = 0005759
+YOR136W = 0005759
+YOR136W = 0005759
+YOR136W = 0005739
+YPL117C = 0005829
+YDL066W = 0005739
+YLR174W = 0005829
+YNL009W = 0005777
+YNL009W = 0005737
+YJL146W = 0008372
+YFL013C = 0008372
+YNL215W = 0008372
+YLR052W = 0008372
+YOR189W = 0008372
+YER092W = 0008372
+YEL044W = 0008372
+YLR223C = 0008372
+YOL023W = 0005739
+YOL023W = 0005739
+YHR187W = 0016591
+YHR187W = 0008023
+YLR384C = 0016591
+YLR384C = 0008023
+YJL057C = 0008372
+YJR118C = 0008372
+YBL076C = 0005829
+YER086W = 0008372
+YMR108W = 0005739
+YMR108W = 0005739
+YJR016C = 0008372
+YLR355C = 0005739
+YCL009C = 0005739
+YAR073W = 0008372
+YHR216W = 0008372
+YLR432W = 0005737
+YML056C = 0008372
+YJR094C = 0005634
+YJL106W = 0005634
+YGL192W = 0008372
+YCR046C = 0005761
+YCR071C = 0005762
+YLR309C = 0005829
+YJR138W = 0008372
+YJL082W = 0008372
+YBR107C = 0005699
+YMR150C = 0005740
+YMR035W = 0005740
+YIL154C = 0008372
+YHR148W = 0005732
+YHR148W = 0030532
+YHR148W = 0005732
+YNL075W = 0005732
+YNL075W = 0030532
+YNL075W = 0005732
+tM(CAU)O1 = 0005829
+tM(CAU)P = 0005829
+tM(CAU)J3 = 0005829
+tM(CAU)E = 0005829
+YDL181W = 0005753
+YHR046C = 0008372
+YJL153C = 0008372
+YDR123C = 0005634
+YOL108C = 0005634
+YGL150C = 0016585
+YIL002C = 0005624
+YNL106C = 0005624
+YOR109W = 0005624
+YOL065C = 0005783
+YLR095C = 0008372
+YFR013W = 0008372
+YMR044W = 0008372
+YHR085W = 0008372
+YHR197W = 0008372
+YNL182C = 0008372
+YDR315C = 0008372
+YPL209C = 0005876
+YPL209C = 0005828
+YBR011C = 0005829
+YDR072C = 0005624
+YPL242C = 0000142
+YBR140C = 0016020
+YBR140C = 0016020
+YOL081W = 0008372
+YHR079C = 0005635
+YHR079C = 0005789
+YIL026C = 0008278
+YIL026C = 0008278
+YKR019C = 0008372
+YLL027W = 0005759
+YPR067W = 0005758
+YER019W = 0008372
+YER180C = 0008372
+YMR081C = 0008372
+YPL040C = 0005739
+YPR106W = 0008372
+YNL265C = 0008372
+YBR086C = 0008372
+YIR005W = 0005686
+YPL135W = 0005759
+YPL135W = 0005739
+YOR226C = 0005759
+YBR245C = 0005634
+YOR304W = 0005634
+YJR050W = 0005681
+YJR050W = 0005681
+YGL133W = 0005634
+YDR497C = 0016020
+YOL103W = 0016020
+YML068W = 0008372
+YDL115C = 0008372
+YPR133C = 0008023
+YKL032C = 0000228
+YGL018C = 0005739
+YJL073W = 0005783
+YJL073W = 0000300
+YKL217W = 0005886
+YKL217W = 0005886
+YLR331C = 0008372
+YDR475C = 0008372
+YPR169W = 0008372
+YMR294W = 0005869
+YJR091C = 0008372
+YKR038C = 0008372
+YBR017C = 0005829
+YGL241W = 0005634
+YGL241W = 0005737
+YPL125W = 0005737
+YPL125W = 0005643
+YGL016W = 0005737
+YGL016W = 0005643
+YER110C = 0005737
+YER110C = 0005643
+YER110C = 0005634
+YER110C = 0005737
+YLR347C = 0005737
+YLR347C = 0005643
+YNL188W = 0005825
+YJL034W = 0005788
+YPR141C = 0005816
+YPR141C = 0005711
+YPR141C = 0005816
+YPR141C = 0005816
+YPR141C = 0005874
+YCL055W = 0005634
+YMR065W = 0005789
+YPL269W = 0005938
+YPL269W = 0005937
+YCL024W = 0005935
+YDR017C = 0008372
+YHR158C = 0005737
+YHR158C = 0005937
+YHR158C = 0005934
+YHR158C = 0005935
+YGR238C = 0005937
+YGR238C = 0005934
+YGR238C = 0005935
+YPL263C = 0008372
+YGL173C = 0005737
+YPL145C = 0008372
+YGL203C = 0005802
+YNL238W = 0005802
+YIL125W = 0005759
+YIL125W = 0005759
+YDR148C = 0005759
+YDR148C = 0005759
+YJL094C = 0016020
+YER187W-A = 0008372
+YHR102W = 0008372
+YDR122W = 0005624
+YLR096W = 0005624
+YDL108W = 0005675
+YAR018C = 0008372
+YOR233W = 0005737
+YCR091W = 0008372
+YBL063W = 0005816
+YBL063W = 0005871
+YBL063W = 0005876
+YPL155C = 0005871
+YPL155C = 0005881
+YGL216W = 0005871
+YGL216W = 0005880
+YGL216W = 0005881
+YKL168C = 0008372
+YDL049C = 0005576
+YDL049C = 0009277
+YLL019C = 0008372
+YHR186C = 0008372
+YNL322C = 0009277
+YGR166W = 0030008
+YDR483W = 0005794
+YIL027C = 0008372
+YER038C = 0008372
+YNL132W = 0008372
+YOR336W = 0005783
+YPR159W = 0016021
+YJL174W = 0005576
+YNL308C = 0005730
+YCL059C = 0005730
+YDR037W = 0005737
+YHR082C = 0005634
+YGR040W = 0005634
+YBL071W-A = 0008372
+YKL110C = 0016591
+YOR099W = 0005794
+YKR061W = 0005794
+YBR205W = 0005624
+YBR199W = 0005794
+YNL029C = 0005794
+YPL053C = 0005624
+YIL085C = 0005794
+YKL008C = 0005783
+YHL003C = 0005783
+YOL025W = 0008372
+YNL239W = 0005737
+YKL103C = 0000324
+YKR063C = 0005634
+YOR181W = 0005857
+YOR181W = 0005737
+YJL062W = 0005887
+YJL062W = 0030176
+YNL071W = 0005739
+YMR296C = 0005624
+YMR296C = 0005792
+YMR296C = 0017059
+YDR062W = 0005624
+YDR062W = 0005792
+YDR062W = 0017059
+YJL134W = 0005783
+YOR171C = 0005624
+YOR171C = 0005625
+YOR171C = 0005794
+YLR260W = 0005624
+YLR260W = 0005625
+YDR499W = 0000228
+YER127W = 0005732
+YER127W = 0030532
+YPL213W = 0005737
+YPL213W = 0005686
+YPL054W = 0008372
+YNL323W = 0016021
+YNL323W = 0005783
+YNL323W = 0005886
+YNL323W = 0005737
+YOR123C = 0016593
+YOR123C = 0008023
+YGL009C = 0005829
+YCL018W = 0005829
+YLR451W = 0005634
+YNL104C = 0005739
+YNL104C = 0005737
+YHR002W = 0005743
+YPL055C = 0008372
+YDL051W = 0005634
+YKL073W = 0005783
+YKL073W = 0005783
+YKL073W = 0005783
+YKL073W = 0005783
+YGL090W = 0005634
+YHR156C = 0005634
+YLR239C = 0008372
+YOR196C = 0005739
+YFR001W = 0005634
+YKL205W = 0016363
+YKL183W = 0008372
+YLR011W = 0008372
+YFL018C = 0005967
+YFL018C = 0005759
+YPL060W = 0005743
+YDR503C = 0016020
+YCL051W = 0009277
+YDL240W = 0008372
+YNR008W = 0005783
+YHR081W = 0008372
+YDR439W = 0005634
+YGR136W = 0005737
+YFR024C-A = 0008372
+YCL034W = 0005938
+YJL100W = 0005624
+YJL100W = 0005737
+YOR142W = 0005759
+YOR142W = 0005759
+YGR244C = 0005759
+YGR244C = 0005759
+YGL099W = 0008372
+YJL124C = 0008372
+YBL026W = 0030532
+YLR438C-A = 0005688
+YER112W = 0030532
+YER146W = 0030532
+YDR378C = 0030532
+YNL147W = 0005688
+YJR022W = 0030532
+YPL004C = 0005737
+LSR1 = 0005686
+YKL176C = 0030120
+YGR057C = 0030120
+YNL006W = 0008372
+YAL024C = 0005933
+YPR073C = 0008372
+YKL143W = 0008372
+YDL087C = 0005685
+YDL087C = 0005685
+YDL087C = 0005685
+YDL087C = 0005685
+YDR027C = 0005794
+YNL268W = 0005886
+YIR034C = 0005737
+YIL094C = 0005739
+YDR034C = 0005634
+YBR115C = 0005737
+YDL182W = 0005634
+YDL182W = 0005634
+YDL131W = 0005634
+YDL131W = 0005634
+YDR234W = 0005739
+YGL154C = 0005737
+YMR038C = 0005829
+YNR050C = 0005737
+YMR021C = 0005634
+YGL086W = 0005634
+YJL030W = 0005634
+YJL013C = 0005634
+YKL029C = 0005739
+YDR005C = 0005634
+YER142C = 0005634
+YLR427W = 0008372
+YPL100W = 0000329
+YPL100W = 0005829
+YEL053C = 0008372
+YKL021C = 0005624
+YAL025C = 0005730
+YDR060W = 0008372
+YPR051W = 0008372
+YCR020C-A = 0008372
+YCR019W = 0008372
+YBR142W = 0005634
+YGR289C = 0005624
+YGR292W = 0008372
+YGR288W = 0005634
+YBR298C = 0005624
+YBR299W = 0008372
+YBR297W = 0005634
+YER106W = 0008372
+YOL060C = 0008372
+YIL070C = 0005759
+YLR244C = 0005830
+YBL091C = 0005737
+YLR163C = 0005759
+YHR024C = 0005759
+YNR017W = 0005744
+YNR017W = 0005739
+HMRA1 = 0005634
+HMRA2 = 0008372
+YCR040W = 0005634
+YCR039C = 0005634
+YBR185C = 0005743
+YJL199C = 0008372
+YOR298C-A = 0005634
+YDL056W = 0005634
+YDL056W = 0005634
+YKL093W = 0008372
+YOR197W = 0005634
+YDL003W = 0008278
+YKL165C = 0009277
+YDL054C = 0016020
+YKL221W = 0016020
+YOL119C = 0000329
+YOR306C = 0016020
+YNL307C = 0005625
+YMR043W = 0005634
+YMR043W = 0005634
+YIL150C = 0005634
+YPR046W = 0005699
+YBL023C = 0005737
+YBL023C = 0005634
+YBL023C = 0005737
+YBL023C = 0005656
+YDR318W = 0005698
+YJR135C = 0005699
+YEL032W = 0005737
+YEL032W = 0005737
+YEL032W = 0005634
+YEL032W = 0005737
+YEL032W = 0005656
+YGL201C = 0005737
+YGL201C = 0005634
+YGL201C = 0005737
+YGL201C = 0005656
+YKL150W = 0005758
+YKL150W = 0005741
+YOR221C = 0005739
+YOR221C = 0005739
+YBR227C = 0005759
+YNL173C = 0005886
+YKL085W = 0005759
+YOL126C = 0005782
+YOL126C = 0005829
+YOL126C = 0005737
+YDL078C = 0005782
+YFL016C = 0005743
+YNL328C = 0005743
+YLR188W = 0005743
+YPL270W = 0005743
+YML104C = 0005882
+YML104C = 0005737
+YAL010C = 0005741
+YOL009C = 0005741
+YOL076W = 0005622
+YLR368W = 0008372
+YHR194W = 0008372
+YOR147W = 0008372
+YGL219C = 0008372
+YKL053C-A = 0008372
+YPR083W = 0008372
+YOL027C = 0008372
+YGL020C = 0008372
+YLR106C = 0005634
+YGR100W = 0005625
+YGL197W = 0005737
+YJL112W = 0005741
+YJL112W = 0005741
+YBR136W = 0008372
+YLR288C = 0005634
+YPR070W = 0000119
+YMR112C = 0000119
+YDL005C = 0000119
+YOR174W = 0000119
+YHR058C = 0000119
+YHR058C = 0000119
+YOL135C = 0000119
+YBR193C = 0000119
+YLR069C = 0005739
+YJL102W = 0005739
+YER044C-A = 0008372
+YPL121C = 0008372
+YOR351C = 0005634
+YGR121C = 0005886
+YGR121C = 0005886
+YGR121C = 0005886
+YNL142W = 0005886
+YPR138C = 0005886
+YPR138C = 0005886
+YPR138C = 0005886
+YNL210W = 0005634
+YGR264C = 0005737
+YKR069W = 0008372
+YFR030W = 0008372
+YPL023C = 0005623
+YGL125W = 0005623
+YGL125W = 0005762
+YKL001C = 0005623
+YPR167C = 0005622
+YLR303W = 0005737
+YIL128W = 0005654
+YNL277W = 0005737
+YOL064C = 0005737
+YIR017C = 0005634
+YJR010W = 0008372
+YIL046W = 0000152
+YPL038W = 0005737
+YPL038W = 0005634
+YPL038W = 0005634
+YDR253C = 0005634
+YNL103W = 0005634
+YER091C = 0005829
+YOR241W = 0005739
+YOR241W = 0005737
+YBR213W = 0008372
+YLR017W = 0005737
+YPL169C = 0005737
+YPL169C = 0005643
+YPL187W = 0005576
+YGL089C = 0005576
+YDR461W = 0005576
+YNL145W = 0005576
+YML062C = 0005634
+YGR249W = 0008372
+YIR033W = 0005789
+YOR232W = 0005759
+YOR232W = 0005739
+YOR211C = 0005758
+YJR144W = 0000262
+YNL218W = 0008372
+YDL200C = 0005634
+YJL042W = 0005874
+YDR296W = 0005634
+YDR296W = 0005739
+YLL062C = 0008372
+YJL104W = 0008372
+YNL291C = 0005886
+YLR332W = 0005887
+YKL089W = 0005634
+YKL089W = 0005698
+YKL089W = 0005699
+YGL035C = 0005737
+YGL035C = 0005634
+YGL035C = 0005634
+YGL035C = 0005737
+YGL209W = 0005634
+YER028C = 0005634
+YMR036C = 0008372
+YOR330C = 0005739
+YHR015W = 0005643
+YJR077C = 0005740
+YJR077C = 0005740
+YJR077C = 0005739
+YBR084W = 0005739
+YDR144C = 0009277
+YOR231W = 0008372
+YPL140C = 0008372
+YNL076W = 0008372
+YNL085W = 0008372
+YGL106W = 0000143
+YPR188C = 0008372
+YNL074C = 0008372
+YMR167W = 0005634
+YLR035C = 0005634
+YPL164C = 0005634
+YKR095W = 0005635
+YKR095W = 0005654
+YIL149C = 0005635
+YIL149C = 0005654
+YNL117W = 0005782
+YNL117W = 0005737
+YIL051C = 0005739
+YIL051C = 0005759
+YLL006W = 0005741
+YLL061W = 0005886
+YLL061W = 0005886
+YPR164W = 0008372
+YGL087C = 0005737
+YGL087C = 0005634
+YEL019C = 0008372
+YLR320W = 0008372
+YBR098W = 0005634
+YMR177W = 0016021
+YMR177W = 0005739
+YPL224C = 0016021
+YPL224C = 0005739
+YGL183C = 0008372
+YIR025W = 0008372
+YOR350C = 0008372
+YHR204W = 0005783
+YER001W = 0005794
+YDR245W = 0000136
+YJL183W = 0000136
+YBR015C = 0005794
+YKL201C = 0008372
+YJL186W = 0005794
+YPL050C = 0000137
+YPL050C = 0000136
+YKL064W = 0016020
+YJR131W = 0005783
+YGL257C = 0008372
+YIL014W = 0008372
+YNR059W = 0008372
+YIL106W = 0005935
+YFL034C-B = 0005933
+YFL034C-B = 0005935
+YFL034C-B = 0005634
+YOR274W = 0005634
+YOR274W = 0005730
+YOR274W = 0005739
+YOR274W = 0005829
+YJR074W = 0005634
+YBL049W = 0008372
+YCL039W = 0008372
+YGL124C = 0008372
+YNL297C = 0005768
+YOL063C = 0008372
+YPL082C = 0000228
+YER068W = 0030015
+YER068W = 0005737
+YMR070W = 0005634
+YNL249C = 0008372
+YOR177C = 0005816
+YOR288C = 0008372
+YOL088C = 0005783
+YKL059C = 0005847
+YIR002C = 0005634
+YDL247W = 0005886
+YJR160C = 0005886
+YJL066C = 0005739
+YJL066C = 0005624
+YJR002W = 0005732
+YJR002W = 0030532
+YJR002W = 0005730
+YJR002W = 0005634
+YJR002W = 0005732
+YDL028C = 0005816
+YDL028C = 0005699
+YGL075C = 0005635
+YGL075C = 0005816
+YJL019W = 0005825
+YJL019W = 0005816
+YGL178W = 0008372
+YCL061C = 0008372
+YPR112C = 0005730
+YMR224C = 0005634
+YMR224C = 0005711
+YMR224C = 0005634
+YGL143C = 0005739
+YGL143C = 0005739
+YDR033W = 0005886
+YGL064C = 0005739
+YDL079C = 0008372
+YPR079W = 0005770
+YPR079W = 0005737
+YGL136C = 0005739
+YDR347W = 0005763
+YDR347W = 0005763
+YDL045W-A = 0005763
+YDL045W-A = 0005763
+YGR084C = 0005763
+YKL003C = 0005763
+YPR166C = 0005763
+YPR166C = 0005763
+YDR405W = 0005762
+YBL090W = 0005763
+YHL004W = 0005763
+YHL004W = 0005763
+YKL167C = 0005762
+YDR036C = 0008372
+YPL118W = 0005763
+YPL118W = 0005763
+YNL005C = 0005762
+YKL142W = 0005761
+YKL142W = 0005761
+YDR116C = 0005762
+YDR116C = 0005762
+YNL284C = 0005762
+YDL202W = 0005762
+YKR006C = 0005762
+YLR312W-A = 0005762
+YBL038W = 0005762
+YNL252C = 0005762
+YNL185C = 0005762
+YKR085C = 0005762
+YNL177C = 0005762
+YNL177C = 0005762
+YOR150W = 0005762
+YMR193W = 0005762
+YGR076C = 0005762
+YBR282W = 0005762
+YDR462W = 0005762
+YMR024W = 0005762
+YKL138C = 0005762
+YCR003W = 0005762
+YMR286W = 0005762
+YDR322W = 0005762
+YBR122C = 0005762
+YBR268W = 0005762
+YKL170W = 0005762
+YML009C = 0005762
+YLR439W = 0005762
+YPL173W = 0005762
+YMR225C = 0005762
+YJL096W = 0005762
+YNR022C = 0005762
+YPR100W = 0005762
+YHR147C = 0005762
+YDR237W = 0005762
+YJL063C = 0005762
+YGR220C = 0005762
+YPL013C = 0005763
+YPL013C = 0005763
+YMR188C = 0005763
+YMR188C = 0005763
+YNL306W = 0005763
+YDR337W = 0005763
+YDR337W = 0005763
+YGR165W = 0005763
+YBR251W = 0005761
+YBR251W = 0005763
+YMR158W = 0005763
+YBR146W = 0005763
+YBR146W = 0005763
+YIR021W = 0008372
+YHR005C-A = 0005758
+YOR334W = 0005743
+YJL133W = 0005739
+YKR052C = 0005739
+YBR091C = 0005758
+YOR370C = 0016020
+YOR370C = 0005737
+YKL009W = 0008372
+YOR188W = 0005935
+YOR188W = 0005934
+YGR014W = 0005887
+YGR014W = 0005887
+YNL293W = 0000131
+YNL293W = 0005934
+YOL112W = 0000131
+YOL112W = 0005934
+YML128C = 0008372
+YDR205W = 0016020
+YDR205W = 0005634
+YDR205W = 0005783
+YLR219W = 0008372
+YOR354C = 0008372
+YHR039C = 0008372
+YPL104W = 0005739
+YPL104W = 0005739
+YOL033W = 0005739
+YPR047W = 0005739
+YKR030W = 0008372
+YNL053W = 0008372
+YHR120W = 0005739
+YOL090W = 0000228
+YCR092C = 0000228
+YFL003C = 0000228
+YDL154W = 0005634
+YDR097C = 0005634
+YBR195C = 0005677
+YBR195C = 0005678
+YBR195C = 0005678
+YNL073W = 0005739
+YNL073W = 0005739
+YIR009W = 0005686
+YLR116W = 0000243
+YGR171C = 0005739
+YGR171C = 0005739
+YOL116W = 0005634
+YMR037C = 0005634
+YKL062W = 0005634
+YDR335W = 0005634
+YDR335W = 0005634
+YNR049C = 0005792
+YGR028W = 0005741
+YHR091C = 0005739
+YMR023C = 0005743
+YMR164C = 0008372
+YDR194C = 0005759
+YPR134W = 0008372
+YDL107W = 0005743
+YDR208W = 0005886
+YLR203C = 0008372
+YKL194C = 0005739
+YMR287C = 0005739
+YDR268W = 0005739
+YPL097W = 0005739
+YKR080W = 0005829
+YMR228W = 0005759
+YDL044C = 0005739
+YMR097C = 0008372
+YDR277C = 0008372
+YGR023W = 0005887
+YGL236C = 0005739
+YOR160W = 0005737
+YOR160W = 0005634
+YKL186C = 0005643
+YGR158C = 0000176
+YGR158C = 0000177
+YJL050W = 0005730
+YAL034W-A = 0030615
+YMR100W = 0008372
+YIR019C = 0005886
+YBR119W = 0005685
+YKL074C = 0000243
+YPL070W = 0008372
+YBR057C = 0008372
+YGR055W = 0005887
+YHL036W = 0016020
+YGR007W = 0008372
+YDR386W = 0008372
+YNR043W = 0005829
+YMR004W = 0005737
+YER042W = 0008372
+YHR023W = 0000142
+YOR326W = 0000141
+YOR326W = 0000143
+YKL129C = 0005857
+YAL029C = 0000143
+YMR109W = 0005857
+YGL122C = 0005634
+YGL122C = 0005634
+YGL122C = 0005737
+YPL190C = 0005654
+YML117W = 0008372
+YNL124W = 0005654
+YLR382C = 0005739
+YMR080C = 0005844
+YMR080C = 0005737
+YHR086W = 0005685
+YHR086W = 0005685
+YHR086W = 0000243
+YHR086W = 0000243
+YHR086W = 0005685
+YNL137C = 0005763
+YNL137C = 0005763
+YPL126W = 0005732
+YKR048C = 0005634
+YNL240C = 0008372
+YGR232W = 0005838
+YDL040C = 0005622
+YDL040C = 0005737
+YGR147C = 0005737
+YPR131C = 0008372
+YOR253W = 0005737
+YLR457C = 0005634
+YDR162C = 0008372
+YGL091C = 0005634
+YPR155C = 0008372
+YJL116C = 0008372
+YDR397C = 0005634
+YJL205C-A = 0008372
+YPR149W = 0016021
+YPR149W = 0005783
+YPR149W = 0005737
+YNL036W = 0005737
+YPL024W = 0008372
+YBL024W = 0005634
+YHR042W = 0005792
+YPL006W = 0008372
+YML031W = 0005643
+YML031W = 0005643
+YML031W = 0005816
+YOR372C = 0005634
+YMR145C = 0005739
+YMR145C = 0005739
+YMR145C = 0005739
+YMR145C = 0005739
+YDL085W = 0005739
+YDL085W = 0005739
+YML120C = 0005748
+YOL104C = 0005696
+YHR124W = 0005711
+YLR265C = 0005634
+YHR004C = 0042175
+YHR004C = 0016021
+YHR004C = 0016021
+YIL048W = 0008372
+YJL076W = 0005730
+YPL226W = 0008372
+YOR156C = 0008372
+YCL017C = 0005739
+YKL040C = 0005759
+YDR176W = 0000124
+YOL042W = 0008372
+YMR285C = 0005622
+YML118W = 0008372
+YBR212W = 0005737
+YLR138W = 0005886
+YDL002C = 0008372
+YDL208W = 0030532
+YPR052C = 0005717
+YBR089C-A = 0005717
+YDR456W = 0005770
+YFR002W = 0005643
+YGL221C = 0008372
+YMR309C = 0005737
+YMR309C = 0005852
+YMR309C = 0005852
+YMR309C = 0005737
+YPL174C = 0005869
+YPL211W = 0005730
+YPL211W = 0005842
+YNL078W = 0005634
+YNL078W = 0005935
+YIL164C = 0008372
+YJL126W = 0008372
+YLR351C = 0008372
+YDR383C = 0008372
+YLR315W = 0008372
+YLR328W = 0008372
+YGR010W = 0005634
+YHR077C = 0005844
+YHR077C = 0005737
+YHR170W = 0005829
+YHR170W = 0005842
+YLR363C = 0008372
+YJR132W = 0005634
+YJR132W = 0005737
+NME1 = 0000172
+YLR195C = 0005829
+YJR112W = 0030615
+YLR285W = 0008372
+YOR056C = 0005837
+YOR206W = 0005634
+YLR002C = 0005634
+YLR002C = 0005730
+YPL093W = 0005730
+YNR053C = 0005634
+YDL014W = 0030532
+YDL014W = 0005730
+YDL014W = 0005732
+YHR072W-A = 0030532
+YOL041C = 0005730
+YNL175C = 0005730
+YNL175C = 0005654
+YDL148C = 0005730
+YDL148C = 0005634
+YDL148C = 0005732
+YNL110C = 0005634
+YNL110C = 0005730
+YER002W = 0005730
+YER002W = 0005634
+YER002W = 0005634
+YNL061W = 0005730
+YPL043W = 0005730
+YOR310C = 0030532
+YOR310C = 0005732
+YDL213C = 0008372
+YGR103W = 0005730
+YGR103W = 0005634
+YOL144W = 0005730
+YIL038C = 0030015
+YIL038C = 0005737
+YPR072W = 0030015
+YPR072W = 0005737
+YDR432W = 0005737
+YDR432W = 0005634
+YDR432W = 0005634
+YBR170C = 0005643
+YBR170C = 0005783
+YMR091C = 0008372
+YNL183C = 0005737
+YEL062W = 0008372
+YOR209C = 0005634
+YGL067W = 0005737
+YGL067W = 0005777
+YNL251C = 0005634
+YDR043C = 0005634
+YBR066C = 0005634
+YDL167C = 0008372
+YGL111W = 0008372
+YER126C = 0005634
+YLR007W = 0005634
+YPL233W = 0030615
+YJL041W = 0005643
+YGR159C = 0005730
+YGR159C = 0005634
+YNL091W = 0008372
+YJR062C = 0008372
+YBR188C = 0005681
+YBR188C = 0005681
+YER009W = 0005635
+YAL015C = 0005634
+YAL015C = 0005739
+YOL043C = 0005634
+YDR001C = 0008372
+YBR001C = 0008372
+YPR031W = 0008372
+YJL208C = 0005743
+YOR373W = 0005816
+YOL069W = 0005816
+YOL069W = 0005816
+YOL069W = 0005698
+YOL069W = 0005698
+YOL069W = 0005698
+YER006W = 0005730
+YER006W = 0005634
+YDR150W = 0005938
+YDR150W = 0005934
+YOR098C = 0005643
+YKL068W = 0005643
+YMR047C = 0005643
+YKL057C = 0005643
+YKR082W = 0005643
+YGL092W = 0005643
+YER105C = 0005643
+YIL115C = 0005643
+YBL079W = 0005643
+YML103C = 0005643
+YJL039C = 0005643
+YLR335W = 0005643
+YDR192C = 0005643
+YGL172W = 0005643
+YGL172W = 0005635
+YMR153W = 0005643
+YGR119C = 0005643
+YAR002W = 0005643
+YJL061W = 0005643
+YDL116W = 0005643
+YJR042W = 0005643
+YGL151W = 0005634
+YPR168W = 0000119
+YHR195W = 0005635
+YLR093C = 0005774
+YKL120W = 0005743
+YAL051W = 0005634
+YKL055C = 0005739
+YKL055C = 0005739
+YNL099C = 0008372
+YGL038C = 0000137
+YKL134C = 0005739
+YKL134C = 0005739
+YPL134C = 0005739
+YPL134C = 0005743
+YOR222W = 0005743
+YML060W = 0005739
+YGR179C = 0005698
+YGL055W = 0005789
+Q0130 = 0000276
+YIL136W = 0005741
+YIL136W = 0005741
+YHL020C = 0005634
+YJR073C = 0005783
+YJL212C = 0008372
+YPR194C = 0008372
+YBR129C = 0008372
+YPR075C = 0005737
+YML065W = 0005664
+YBR060C = 0005664
+YLL004W = 0005664
+YPR162C = 0005664
+YNL261W = 0005664
+YHR118C = 0005664
+YGR038W = 0008372
+YLR350W = 0005789
+YOR130C = 0005740
+YAR044W = 0000138
+YAR044W = 0005769
+YDL019C = 0005886
+YDL019C = 0005935
+YHR073W = 0005737
+YKR003W = 0008372
+YHR001W = 0008372
+YJR051W = 0005737
+YJL002C = 0005788
+YJL002C = 0008250
+YOR103C = 0008250
+YOR085W = 0016021
+YOR085W = 0008250
+YDL232W = 0005789
+YGL226C-A = 0008250
+YML019W = 0008250
+YER154W = 0005743
+YPL196W = 0008372
+YHR179W = 0008372
+YPL171C = 0008372
+YER165W = 0005840
+YER165W = 0005737
+YER165W = 0005634
+YOR269W = 0005737
+YGR078C = 0005737
+YDR488C = 0005623
+YER007W = 0005737
+YDR538W = 0008372
+YBR279W = 0008023
+YMR174C = 0005737
+YER129W = 0008372
+YDR251W = 0008372
+YIR006C = 0005857
+YIR006C = 0005886
+YGL094C = 0008372
+YKL025C = 0008372
+YHR063C = 0008372
+YIL145C = 0008372
+YKR002W = 0005654
+YCR077C = 0005843
+YJL223C = 0008372
+YEL049W = 0008372
+YCR104W = 0008372
+YLR461W = 0008372
+YFL020C = 0008372
+YNR076W = 0008372
+YAR020C = 0008372
+YNL015W = 0005737
+YNL015W = 0000324
+YCL052C = 0005783
+YGR178C = 0005737
+YGR178C = 0005634
+YBR233W = 0008372
+YJL128C = 0005737
+YBR295W = 0016020
+YBR295W = 0016020
+YLR151C = 0005777
+YDR228C = 0005849
+YBR186W = 0005730
+YIL071C = 0008180
+YKR097W = 0005829
+YNL289W = 0000307
+YGL134W = 0000307
+YDL127W = 0000307
+YHR071W = 0000307
+YER059W = 0000307
+YIL050W = 0000307
+YPL219W = 0000307
+YDL179W = 0000307
+YEL058W = 0005737
+YGR101W = 0005739
+YGR202C = 0005794
+YGR202C = 0005634
+YGR202C = 0005635
+YER178W = 0005739
+YER178W = 0045254
+YBR221C = 0005739
+YBR221C = 0045254
+YLR044C = 0008372
+YDR081C = 0005634
+YLR134W = 0008372
+YGR087C = 0008372
+YGL248W = 0008372
+YOR360C = 0008372
+YPR002W = 0008372
+YCL043C = 0005788
+YGL013C = 0005634
+YOR328W = 0005886
+YIL013C = 0016020
+YPL058C = 0005886
+YDR406W = 0016021
+YNL231C = 0005737
+YNL264C = 0005737
+YNR070W = 0008372
+YBL005W = 0005737
+YBL005W = 0005634
+YBL005W = 0005634
+YOR153W = 0005886
+YLR266C = 0008372
+YDR113C = 0005634
+YDR113C = 0005819
+YMR076C = 0005708
+YGR193C = 0005739
+YGR193C = 0005967
+YBR035C = 0008372
+YER149C = 0000133
+YER149C = 0000143
+YBL017C = 0005794
+YOR036W = 0005768
+YOR036W = 0005794
+YOR036W = 0000324
+YLR148W = 0000306
+YLR148W = 0000329
+YPL154C = 0000324
+YMR231W = 0000329
+YDR323C = 0005737
+YDR323C = 0019897
+YJL053W = 0005768
+YCR044C = 0008372
+YFR023W = 0005634
+YKR046C = 0005811
+YDR079W = 0005743
+YMR257C = 0005743
+YBL080C = 0005739
+YER058W = 0005743
+YER153C = 0005743
+YOR158W = 0005763
+YOR158W = 0005763
+YOR017W = 0005740
+YJL023C = 0008372
+YCR020C = 0008372
+YJR034W = 0005743
+YLR067C = 0005743
+YLR067C = 0016021
+YNR045W = 0005743
+YGR222W = 0005743
+YGR222W = 0005759
+YOR201C = 0005739
+YNL003C = 0005743
+YBL030C = 0005743
+YKL197C = 0008372
+YDR265W = 0008372
+YOL147C = 0005778
+YMR026C = 0005778
+YLR191W = 0005778
+YGL153W = 0005778
+YGL153W = 0005778
+YOL044W = 0005778
+YNL214W = 0005778
+YHR160C = 0005777
+YHR160C = 0005829
+YDL065C = 0005829
+YJL210W = 0008372
+YGR239C = 0005777
+YGR239C = 0005829
+YAL055W = 0005777
+YPL112C = 0005778
+YDR329C = 0005778
+YGR133W = 0005777
+YDR244W = 0005777
+YDR244W = 0005829
+YNL329C = 0005777
+YDR142C = 0005782
+YGR077C = 0005782
+YGR077C = 0005778
+YJL179W = 0016272
+YJL179W = 0016272
+YGR240C = 0005945
+YGR240C = 0005737
+YMR205C = 0005945
+YMR205C = 0005737
+YIL107C = 0005737
+YOL136C = 0005737
+YHR185C = 0008372
+YNL317W = 0005847
+YOR122C = 0000142
+YOR122C = 0000143
+YGL025C = 0000119
+YBR196C = 0005829
+YCR012W = 0005829
+YCR012W = 0005737
+YKL127W = 0005829
+YKL127W = 0005737
+YMR105C = 0005829
+YCL004W = 0005739
+YJR153W = 0005576
+YNL316C = 0008372
+YGR132C = 0005739
+YGR231C = 0005739
+YKL043W = 0005634
+YDR281C = 0008372
+YOL084W = 0008372
+YER037W = 0008372
+YAR071W = 0005576
+YHR215W = 0008372
+YDL236W = 0008372
+YDL106C = 0008372
+YNL097C = 0005634
+YBR092C = 0030287
+YBR092C = 0030287
+YOL002C = 0016021
+YFR034C = 0005634
+YFR034C = 0005737
+YBR093C = 0009277
+YBR093C = 0030287
+YDR481C = 0000329
+YOL001W = 0000307
+YGR233C = 0008372
+YML123C = 0005887
+YML123C = 0005887
+YPL031C = 0005634
+YJL117W = 0005783
+YCR037C = 0016020
+YBR106W = 0016020
+YBR296C = 0005886
+YBR296C = 0005886
+YJL198W = 0016020
+YNR013C = 0016020
+YOR386W = 0005634
+YDR313C = 0000329
+YDR313C = 0005770
+YGL023C = 0005770
+YML061C = 0005739
+YLR273C = 0000164
+YIL045W = 0008372
+YNL267W = 0005634
+YNL267W = 0005794
+YGR086C = 0008372
+YBL022C = 0005759
+YBL022C = 0005759
+YBL022C = 0005759
+YOR104W = 0008372
+YPR154W = 0008372
+YBL051C = 0008372
+YOR363C = 0005634
+YKL164C = 0005618
+YKL163W = 0005618
+YPR113W = 0005783
+YBL105C = 0008372
+YDR490C = 0005829
+YOL100W = 0005634
+YMR123W = 0008372
+YMR008C = 0009277
+YMR006C = 0009277
+YMR006C = 0005615
+YOL011W = 0005615
+YOL011W = 0005615
+YOL011W = 0005886
+YPL268W = 0005699
+YPL268W = 0005698
+YPL268W = 0005634
+YDR501W = 0008372
+YPR179C = 0008372
+YDR295C = 0008372
+YDR183W = 0005737
+YOR281C = 0005737
+YGL008C = 0005783
+YGL008C = 0005886
+YPL036W = 0005886
+YGL006W = 0000329
+YER132C = 0008372
+YER003C = 0008372
+YCR024C-A = 0016020
+YEL017C-A = 0016020
+YDR276C = 0005886
+YGL167C = 0005794
+YNL082W = 0000228
+YDL095W = 0005789
+YAL023C = 0005783
+YOR321W = 0005783
+YJR143C = 0005783
+YDL093W = 0005783
+YGR199W = 0005783
+YKL128C = 0008372
+YGL037C = 0008372
+YPL096W = 0005634
+YPL096W = 0005829
+YLR209C = 0008372
+YOR266W = 0005743
+YML069W = 0005634
+YIL122W = 0005634
+YIL122W = 0005634
+YNL102W = 0005658
+YBL035C = 0005658
+YNL262W = 0005657
+YBR088C = 0005657
+YJR043C = 0005659
+YJR043C = 0005634
+YCR014C = 0005634
+YEL055C = 0005730
+YMR129W = 0005643
+YMR129W = 0005643
+YLR018C = 0005643
+YLR018C = 0005643
+YNL221C = 0000172
+YNL221C = 0005655
+YNR052C = 0030015
+YNR052C = 0005737
+YNL282W = 0000172
+YNL282W = 0005655
+YBR257W = 0000172
+YBR257W = 0005655
+YAL033W = 0000172
+YAL033W = 0005655
+YGR030C = 0000172
+YGR030C = 0005655
+YBR167C = 0000172
+YBR167C = 0005655
+YBL018C = 0000172
+YBL018C = 0005655
+YNL055C = 0005741
+YIL114C = 0005739
+YIL114C = 0005741
+YPL188W = 0008372
+YIL160C = 0005782
+YGL205W = 0005782
+YHR026W = 0000220
+YHR026W = 0000220
+YMR267W = 0005739
+YMR267W = 0005739
+YHR075C = 0008372
+YNR032W = 0008372
+YDL134C = 0000159
+YDL188C = 0000159
+YDR075W = 0008372
+YDR435C = 0008372
+YOL141W = 0008372
+YDR452W = 0005774
+YDR452W = 0005774
+YPL179W = 0008372
+YLR014C = 0005634
+YBR276C = 0008372
+YGR123C = 0008372
+YPL148C = 0005739
+YHR201C = 0005737
+YML016C = 0005634
+YML016C = 0005737
+YML016C = 0005634
+YDR436W = 0008372
+YEL060C = 0000324
+YMR297W = 0005737
+YMR297W = 0005783
+YCL057W = 0005737
+YCL057W = 0005737
+YCL057W = 0005758
+YER012W = 0005839
+YER012W = 0005839
+YOR362C = 0005839
+YOR362C = 0005839
+YPR103W = 0005839
+YPR103W = 0005839
+YJL001W = 0005839
+YJL001W = 0005839
+YFR050C = 0005839
+YFR050C = 0005839
+YMR314W = 0005839
+YMR314W = 0005839
+YOL038W = 0005839
+YOL038W = 0005839
+YBL041W = 0005839
+YBL041W = 0005839
+YML092C = 0005839
+YML092C = 0005839
+YGR135W = 0005839
+YGR135W = 0005839
+YIR008C = 0005658
+YKL045W = 0005658
+YIL095W = 0005857
+YNL279W = 0016021
+YNL279W = 0005937
+YJL108C = 0016021
+YIL037C = 0016021
+YPL192C = 0016021
+YPL156C = 0016021
+YIL117C = 0016021
+YML047C = 0016021
+YDL039C = 0016021
+YGL053W = 0016021
+YAR031W = 0016021
+YDR300C = 0008372
+YOR323C = 0005737
+YER023W = 0005737
+YDL043C = 0005686
+YMR302C = 0005743
+YKR086W = 0005681
+YGR006W = 0005681
+YLL036C = 0005681
+YLL036C = 0005681
+YLL036C = 0005737
+YLL036C = 0005634
+YNR011C = 0005634
+YNR011C = 0005681
+YJL203W = 0005686
+YER013W = 0005681
+YMR268C = 0005681
+YDR243C = 0005681
+YDR473C = 0030532
+YGR091W = 0030532
+YGR075C = 0030532
+YML046W = 0005685
+YML046W = 0005685
+YML046W = 0000243
+YML046W = 0000243
+YML046W = 0005685
+YPR178W = 0030532
+YKL012W = 0005685
+YKL012W = 0005685
+YKL012W = 0000243
+YKL012W = 0000243
+YKL012W = 0005685
+YDR235W = 0005685
+YDR235W = 0005685
+YDR235W = 0000243
+YDR235W = 0000243
+YDR235W = 0005685
+YGL120C = 0005681
+YAL032C = 0005634
+YPL151C = 0005681
+YBR237W = 0005681
+YBR055C = 0030532
+YHR165C = 0030532
+YDL030W = 0005686
+YKL116C = 0008372
+YDL214C = 0008372
+YKL181W = 0008372
+YER099C = 0008372
+YHL011C = 0008372
+YBL068W = 0008372
+YOL061W = 0008372
+YOR361C = 0005737
+YOR361C = 0005852
+YOR361C = 0005852
+YJL079C = 0005635
+YJL079C = 0005783
+YKR013W = 0008372
+YJL078C = 0009277
+YDL055C = 0005737
+YNL169C = 0005739
+YGR170W = 0000139
+YGR170W = 0000329
+YMR308C = 0005634
+YMR308C = 0005737
+YOL054W = 0008372
+YAL017W = 0008372
+YOL045W = 0008372
+YMR137C = 0005634
+YDR505C = 0008372
+YML017W = 0008372
+YLL010C = 0005886
+YLR019W = 0005886
+YDR055W = 0009277
+YDR032C = 0008372
+YKL076C = 0008372
+YNL201C = 0008372
+YLR376C = 0008372
+YAL043C = 0005847
+YAL043C = 0005849
+YDL006W = 0005634
+YDL006W = 0005737
+YER089C = 0008372
+YBL056W = 0008372
+YBR125C = 0008372
+YOR090C = 0008372
+YHR076W = 0005739